All public logs
Jump to navigation
Jump to search
Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 11:13, 15 March 2024 WikiSysop talk contribs uploaded File:Struc alig 1k7c 1wab.jpeg
- 11:12, 15 March 2024 WikiSysop talk contribs created page File:1k7c 1wab pymol.png
- 11:12, 15 March 2024 WikiSysop talk contribs uploaded File:1k7c 1wab pymol.png
- 11:12, 15 March 2024 WikiSysop talk contribs created page File:1k7c.png
- 11:12, 15 March 2024 WikiSysop talk contribs uploaded File:1k7c.png
- 11:11, 15 March 2024 WikiSysop talk contribs created page Protein Structure and Visualization Answers (Created page with "=Protein Structure and Visualization - Answers= '''Written by:''' Anne Mølgaard, Thomas Blicher, Rasmus Wernersson (wiki version) == Q1 Rhamnogalacturonan acetylesterase in UniProt == *a) The signal peptide is from residue number 1 to 17. *b) The mature protein is from residue number 18 to 250, which means that the protein consists of 233 residues. *c) The active site is made up of three residues. The first is '''Ser26''', the two others are '''Asp209''' and '''His212'...")
- 11:10, 15 March 2024 WikiSysop talk contribs created page File:RGAE active site.png
- 11:10, 15 March 2024 WikiSysop talk contribs uploaded File:RGAE active site.png
- 11:09, 15 March 2024 WikiSysop talk contribs created page File:1K7C page.png
- 11:09, 15 March 2024 WikiSysop talk contribs uploaded File:1K7C page.png
- 11:09, 15 March 2024 WikiSysop talk contribs created page File:PDB homepage.png
- 11:09, 15 March 2024 WikiSysop talk contribs uploaded File:PDB homepage.png
- 11:08, 15 March 2024 WikiSysop talk contribs created page Protein Structure and Visualization (Created page with "''By Anne Mølgaard and Thomas Holberg Blicher with some updates/editing by Rasmus Wernersson'' == Overview == In this practical you will learn how to * Search the Protein Structure Databank for information. * Critically choose the best structure, when more than one is available. * Visualize a protein structure and highlight features of interest. You will work with the protein Rhamnogalacturonan acetylesterase (RGAE) from the fungus ''Aspergillus aculeatus''. It is one...")
- 10:57, 15 March 2024 WikiSysop talk contribs created page File:NCBI BlastP CLONE12 best hit.png
- 10:57, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI BlastP CLONE12 best hit.png
- 10:56, 15 March 2024 WikiSysop talk contribs created page File:NCBI BlastP CLONE12 rframe1 ORF new version.png
- 10:56, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI BlastP CLONE12 rframe1 ORF new version.png
- 10:56, 15 March 2024 WikiSysop talk contribs created page File:NCBI BlastN CLONE12 Graphic Summary.png
- 10:56, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI BlastN CLONE12 Graphic Summary.png
- 10:55, 15 March 2024 WikiSysop talk contribs created page File:NCBI BlastN CLONE12 new version.png
- 10:55, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI BlastN CLONE12 new version.png
- 10:55, 15 March 2024 WikiSysop talk contribs created page File:Peptidases S8.png
- 10:55, 15 March 2024 WikiSysop talk contribs uploaded File:Peptidases S8.png
- 10:54, 15 March 2024 WikiSysop talk contribs created page ExBlast-Answers (Created page with "Answers to the BLAST exercise, by Henrik Nielsen. Values for database sizes etc. retrieved March 7, 2020 ==Part 1: Your first BLAST search== ===QUESTION 1.1=== * ''what is the identifier (Accession)?'' :OL351605 or M57671 (Note that the latter was also part of the sequence name for your query sequence!) * ''what is the alignment score ("max score")?'' :780 * ''what is the percent identity and query coverage?'' :they are both 100% * ''what is the E-value?'' :0.0 (actua...")
- 10:53, 15 March 2024 WikiSysop talk contribs created page File:BLAST limit search.png
- 10:53, 15 March 2024 WikiSysop talk contribs uploaded File:BLAST limit search.png
- 10:51, 15 March 2024 WikiSysop talk contribs created page File:Homo Ortho Para-log.gif
- 10:51, 15 March 2024 WikiSysop talk contribs uploaded File:Homo Ortho Para-log.gif
- 10:50, 15 March 2024 WikiSysop talk contribs created page File:Tic mark job completed.png
- 10:50, 15 March 2024 WikiSysop talk contribs uploaded File:Tic mark job completed.png
- 10:49, 15 March 2024 WikiSysop talk contribs created page File:Save a copy in drive.png
- 10:49, 15 March 2024 WikiSysop talk contribs uploaded File:Save a copy in drive.png
- 10:49, 15 March 2024 WikiSysop talk contribs created page File:Reconnect to a hosted runtime.png
- 10:49, 15 March 2024 WikiSysop talk contribs uploaded File:Reconnect to a hosted runtime.png
- 10:48, 15 March 2024 WikiSysop talk contribs created page File:Runtime disconnected.png
- 10:48, 15 March 2024 WikiSysop talk contribs uploaded File:Runtime disconnected.png
- 10:48, 15 March 2024 WikiSysop talk contribs created page File:Blast exercise in Colab.png
- 10:48, 15 March 2024 WikiSysop talk contribs uploaded File:Blast exercise in Colab.png
- 10:47, 15 March 2024 WikiSysop talk contribs created page Exercise: BLAST2 (Created page with "Exercise written by [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] and modified by Henrik Nielsen and Carolina Barra ==Introduction== In this exercise, we will be using BLAST ('''B'''asic '''L'''ocal '''A'''lignment '''S'''earch '''T'''ool) for searching sequence databases such as GenBank (DNA data) and UniProt (protein). When using BLAST for sequence searches it is of utmost importance to be able to cr...")
- 10:45, 15 March 2024 WikiSysop talk contribs created page ExPairwiseAlignment-Answers (Created page with "Svar til parvis alignment øvelsen Note: There is also an English version: ExPairwiseAlignment-AnswersEng. Svar til Parvis Alignment øvelsen ---------------------------------- Af: Rasmus Wernersson & Henrik Nielsen =Question 1= * Which sequence format are the two sequences listed in? FASTA format. =Question 2= Report the following values / observations from the alignment * Alignment score? * Alignment length? * % and fraction Identity (The value reported f...")
- 10:44, 15 March 2024 WikiSysop talk contribs created page File:Interactive NW example.png
- 10:44, 15 March 2024 WikiSysop talk contribs uploaded File:Interactive NW example.png
- 10:43, 15 March 2024 WikiSysop talk contribs created page ExPairwiseAlignment-AnswersEng (Created page with "'''Answers to pairwise alignment exercise (English version)''' * The exercise itself is here: ExPairwiseAlignment * The Danish version of the answers is here: ExPairwiseAlignment-Answers == Part 0== ===Q0=== Yes, the matrix has the same values in the cells as the one from the lecture. Image:Interactive_NW_example.png == Part 1== ===Q1=== FASTA format. ===Q2=== # Length: 361 # Identity: 176/361 (48.8%) # Similarity: 214/361 (59.3%) # Gaps: 92/36...")
- 10:42, 15 March 2024 WikiSysop talk contribs created page ExUniProt-answers (Created page with " The numbers are found using UniProt Beta on Sep 12, 2022 ==Simple text mining== '''QUESTION 1.1:''' # How many hits do you find? <br>4,796 # How many of these hits are from Swiss-Prot? <br>1,667 # Can you identify the correct hit (''i.e.'' see which one is actually human insulin and not something else)? <br>It's P01308 / INS_HUMAN (not the top hit, but still on the first page). '''QUESTION 1.2:''' How many hits are now left? How many of these are from Swiss-Prot? <b...")
- 10:42, 15 March 2024 WikiSysop talk contribs created page ExTranslation-answers (Created page with "Answers by: Francisco Roque and Nils Weinhold (Some editing by Rasmus Wernersson and Henrik Nielsen) ==Step 1: Basic translation== '''QUESTION 1:''' # How is a STOP codon displayed? <br> <tt>***</tt> # How is a START codon displayed? <br> <tt>>>></tt> (Strict, ''i.e.'' "ATG") <br> <tt>)))</tt> (Alternative, ''i.e.'' "TTG" and "CTG") # Does a start-codon always code for Methionine (M)? <br> Yes - but only if it's actually used as a start codon (see the Instructions tab...")
- 10:40, 15 March 2024 WikiSysop talk contribs created page ExGenbank-new-answers (Created page with "Note: numbers in Part 2 and Part 3 are updated on September 6, 2023. == Part 1 == ;QUESTION 1.1: :a) Inspecting the FEATURE table of the entry reveals that two CDS regions are defined; therefore there are two genes in this entry. As stated on the GenBank hand-out "CDS" is the most stable definition of a protein coding gene used in the GenBank format - sometimes "gene" will also be present, but CDS is more commonly used. :b) ''Columba livia'' (Rock pigeon / domestic pig...")
- 16:24, 14 March 2024 WikiSysop talk contribs created page ExTaxonomy (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa...")
- 16:21, 14 March 2024 WikiSysop talk contribs created page ExTaxonomy-Answers (Created page with "=Answers to the Taxonomy exercise= Answers by: Rasmus Wernersson ==Question 1:== === a)=== Quite a lot extinct groups are encountered along the way - this is marked by a small cross-shaped icon next to the group. Many of these groups do not have a page dedicated to them but are there for putting the taxonomical placement of modern groups into context. A good example of an "important" extinct group which has a dedicated page is "[http://www.tolweb....")
- 16:19, 14 March 2024 WikiSysop talk contribs created page ExJEdit (Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC...")
- 16:17, 14 March 2024 WikiSysop talk contribs created page ExJEdit-Answers (Created page with "=Answer to the JEdit exercise= '''Notice:''' here the answers are written in text-only format, to illustrate what answers can look like written in JEdit. EXERCISE: jEdit ---------------- Answers by: Rasmus Wernersson (v18103) Question 1: ----------- The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newli...")