User contributions for WikiSysop

15 March 2024

• 17:4417:44, 15 March 2024 diff hist +2‎ m Exercise: BLAST ‎ →‎BLASTP search
• 17:4317:43, 15 March 2024 diff hist 0‎ N File:NCBI BALST select seq.png ‎No edit summary current
• 17:4217:42, 15 March 2024 diff hist 0‎ N File:Blastn cropped+circle.png ‎No edit summary current
• 17:4117:41, 15 March 2024 diff hist +30,353‎ N Exercise: BLAST ‎ Created page with "Exercise written by [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] and modified by Henrik Nielsen. ==Introduction== In this exercise we will be using BLAST ('''B'''asic '''L'''ocal '''A'''lignment '''S'''earch '''T'''ool) for searching sequence databases such as GenBank (DNA data) and UniProt (protein). When using BLAST for sequence searches it is of utmost importance to be able to critically evaluate t..."
• 13:0713:07, 15 March 2024 diff hist 0‎ Bioinformatics in practice, Faroe Islands 2022 ‎ →‎Afternoon: Phylogenetic trees
• 13:0513:05, 15 March 2024 diff hist 0‎ Bioinformatics in practice, Faroe Islands 2022 ‎ →‎Afternoon: GenBank
• 13:0313:03, 15 March 2024 diff hist +386‎ Bioinformatics in practice, Faroe Islands 2022 ‎No edit summary
• 12:5112:51, 15 March 2024 diff hist −262‎ 22111 - Introduction to Bioinformatics ‎ →‎Course programme
• 12:5012:50, 15 March 2024 diff hist +7,027‎ N Bioinformatics in practice, Faroe Islands 2022 ‎ Created page with "This is the home page for week 44+45 of the "Bioinformatics in practice" course, Faroe Islands 2022. These five days are taught by [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] and [https://globe.ku.dk/staff-list/hologenomics/?id=271131&vis=medarbejder Bent Petersen]. == Wednesday November 2 == === Morning: Introduction, plain text files and taxonomy databases === '''Lectures:''' * ''[https://teaching.he..."
• 12:4912:49, 15 March 2024 diff hist +22,094‎ N 27611: Kursusplan for forår 2017 ‎ Created page with "'''NB:''' Dette er en ''foreløbig'' kursusplan; ændringer kan forekomme! ==Generel information== ===Undervisere / forelæsere=== * [http://www.cbs.dtu.dk/staff/show-staff.php?id=535 Henrik Nielsen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/staff/show-staff.php?id=758 Bent Petersen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/~raz/ Rasmus Wernersson] — Ekstern lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/staff/show-staff.php..." current
• 12:4912:49, 15 March 2024 diff hist +23,023‎ N 22111:Kursusplan for forår 2018 ‎ Created page with "<!-- '''NB:''' Dette er en ''foreløbig'' kursusplan; ændringer kan forekomme! --> ==Generel information== ===Undervisere / forelæsere=== * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] — Lektor, kursusansvarlig. * [http://www.dtu.dk/service/telefonbog/person?id=21811&cpid=214076&tab=1 Bent Petersen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/~raz/ Rasmus Wernersson] — Ekste..." current
• 12:4812:48, 15 March 2024 diff hist +18,810‎ N 22111:Course plan spring 2019 ‎ Created page with "== General information == === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] — Associate professor, course responsible. * [https://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] — External associate professor, course responsible. * [http://www.dtu.dk/service/telefonbog/person?id=34983&cpid=214024&tab=2&qt=dtupublicationqu..." current
• 12:4712:47, 15 March 2024 diff hist +20,564‎ N 22111:Course plan spring 2020 ‎ Created page with "== General information == === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik Nielsen] — Associate professor, course responsible. * [https://www.dtu.dk/service/telefonbog/person?id=18103&tab=2&qt=dtupublicationquery Rasmus Wernersson] — External associate professor, course responsible. * [http://www.dtu.dk/service/telefonbog/person?id=34983&tab=2&qt=dtupublicationquery Paolo Marcatili] &md..." current
• 12:4712:47, 15 March 2024 diff hist +22,746‎ N 22111:Course plan spring 2021 ‎ Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Feb 2 at 13:00'''. '''In 2021, the course will be held online during the entire semester.''' <!-- Depending on the development in the Corona situation, we may later switch to physical presence. The information here will be updated, as soon as we know more. --> For online lectures and exercises, we use Mi..." current
• 12:4512:45, 15 March 2024 diff hist +21,378‎ N 22111:Course plan spring 2022 ‎ Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Feb 1 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 32''', and the exercises will then take place in '''building 210, rooms 142+148 and 112+118'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery He..." current
• 12:4112:41, 15 March 2024 diff hist +21,133‎ N 22111:Course plan autumn 2022 ‎ Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Aug 30 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 32''', and the exercises will then take place in '''building 210, rooms 112+118, 142+148, and 162'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationqu..." current
• 12:3812:38, 15 March 2024 diff hist 0‎ Exercise: Phylogeny - Answers (Seaview version) ‎ →‎Step 6 current
• 12:3712:37, 15 March 2024 diff hist +74‎ m Exercise: Phylogeny - Answers (Seaview version) ‎ →‎Step 9
• 12:3612:36, 15 March 2024 diff hist 0‎ N File:Ribosomal proteins 34-NJ tree.annotated-iTOL.png ‎No edit summary current
• 12:3612:36, 15 March 2024 diff hist 0‎ N File:Ribosomal proteins 34-NJ tree.rerooted-iTOL.png ‎No edit summary current
• 12:3612:36, 15 March 2024 diff hist 0‎ N File:Ribosomal proteins 34-NJ tree.rerooted-Seaview.png ‎No edit summary current
• 12:3512:35, 15 March 2024 diff hist 0‎ N File:Ribosomal proteins 34-NJ tree.unrooted.png ‎No edit summary current
• 12:3412:34, 15 March 2024 diff hist 0‎ N File:L18 Common Taxonomy Tree.png ‎No edit summary current
• 12:3412:34, 15 March 2024 diff hist 0‎ N File:L18 CDS-NJ tree.revtrans.wgaps.png ‎No edit summary current
• 12:3412:34, 15 March 2024 diff hist 0‎ N File:L18 CDS-NJ tree.revtrans.nogaps.png ‎No edit summary current
• 12:3312:33, 15 March 2024 diff hist 0‎ N File:Pol21-NJ tree.swapped.png ‎No edit summary current
• 12:3312:33, 15 March 2024 diff hist 0‎ N File:Pol21-NJ tree.unrooted.png ‎No edit summary current
• 12:3212:32, 15 March 2024 diff hist 0‎ N File:Pol21-NJ tree.png ‎No edit summary current
• 12:3212:32, 15 March 2024 diff hist −25‎ Exercise: Phylogeny - Answers (Seaview version) ‎ →‎Step 2
• 12:3112:31, 15 March 2024 diff hist +6,682‎ Exercise: Phylogeny - Answers (Seaview version) ‎ →‎Step 2
• 12:3012:30, 15 March 2024 diff hist +42‎ Exercise: Phylogeny - Answers (Seaview version) ‎ →‎Step 1
• 12:2712:27, 15 March 2024 diff hist +7,332‎ N Exercise: Phylogeny - Answers (Seaview version) ‎ Created page with "== Step 1 == Here is a PDF with the aligned sequences. ==Step 2== Here is the text file with the pairwise distances. It is clear that the sequence HTLV shows larger distances than all the other sequences, with all distances being above 0.7. ==Step3== Here is a picture of the NJ tree: File:Pol21-NJ_tree.png The longest branch is the one leading to HTLV, which is in good agreement with the observation in the prev..."
• 12:2612:26, 15 March 2024 diff hist +125‎ Exercise: Multiple Alignments Answers (Seaview version) ‎ →‎Question 1 current
• 12:2512:25, 15 March 2024 diff hist 0‎ N File:EPB4.1 human.mafft.fasta.png ‎No edit summary current
• 12:2412:24, 15 March 2024 diff hist 0‎ N File:EPB4.1 human.clustalo.fasta.png ‎No edit summary current
• 12:2412:24, 15 March 2024 diff hist 0‎ N File:Seaview-Q5.png ‎No edit summary current
• 12:2312:23, 15 March 2024 diff hist 0‎ N File:Seaview-Q2-tree.png ‎No edit summary current
• 12:2312:23, 15 March 2024 diff hist 0‎ N File:Seaview-Q2-aligned.png ‎No edit summary current
• 12:2212:22, 15 March 2024 diff hist +19,425‎ N Exercise: Multiple Alignments Answers (Seaview version) ‎ Created page with " By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAG AGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACC CTGTCAACTTCAAG..."
• 12:1912:19, 15 March 2024 diff hist +5,089‎ N ExGeany-Answers ‎ Created page with "=Answers to the exercise in Plain text files and Geany= Answers by: Rasmus Wernersson and Henrik Nielsen == Question 1:== The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newlines actually consists of two bytes (CR + LF), whereas UNIX and the old Mac standard only use one byte. The 8 byte difference corresponds to the 8 lines of te..." current
• 12:1412:14, 15 March 2024 diff hist +23,383‎ N ExBlast-Answers2 ‎ Created page with "Answers to the BLAST exercise, by Henrik Nielsen. Values for database sizes etc. retrieved March 7, 2020 ==Part 1: Your first BLAST search== ===QUESTION 1.1=== * ''what is the identifier (Accession)?'' :OL351605 or M57671 (Note that the latter was also part of the sequence name for your query sequence!) * ''what is the alignment score ("Max score in bits")?'' :The max score is 780 bits (Raw score is 864) * ''what is the percent identity and query coverage?'' :100% * '..."
• 11:5211:52, 15 March 2024 diff hist +42‎ FAQ ‎ →‎Sequence weighting / Clustering
• 11:5111:51, 15 March 2024 diff hist −2‎ FAQ ‎ →‎Sequence logos
• 11:5111:51, 15 March 2024 diff hist 0‎ N File:Gaps-2014-1g.JPG ‎No edit summary current
• 11:5011:50, 15 March 2024 diff hist +15,278‎ N FAQ ‎ Created page with "== Practical information == === Exam === * ''How do I find out where and when the exam is held?'' At http://www.eksamensplan.dtu.dk/ . * ''Which online platform will you use for the exam?'' This year we will be using Digital Exam (the new interface) which is accessed via https://eksamen.dtu.dk/ . We will ''not'' be using the old interface via http://onlineeksamen.dtu.dk/ . <!-- === COVID-19 information 2021 === This year, the written exam will be a '''home exam'''...."
• 11:4911:49, 15 March 2024 diff hist −6‎ Link collection ‎ →‎Weight matrices and sequence logos current
• 11:4911:49, 15 March 2024 diff hist −2‎ Link collection ‎ →‎Multiple alignment
• 11:4811:48, 15 March 2024 diff hist −2‎ Link collection ‎ →‎Translation
• 11:4811:48, 15 March 2024 diff hist +4,302‎ N Link collection ‎ Created page with "== Taxonomy == ;Tree of Life http://www.tolweb.org/ :(Good descriptive Taxonomy database — limited range of organisms). ;NCBI Taxonomy http://www.ncbi.nlm.nih.gov/Taxonomy/ :(Somewhat "technical" but very exhaustive taxonomical database. TaxIDs are also used in GenBank and UniProt). : The "Common Tree" function can be used to investigate how closely related two or more organisms are: http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi : NCBI search with "Toke..."
• 11:4611:46, 15 March 2024 diff hist +28‎ Checklist for computers ‎ →‎Software