User contributions for WikiSysop

A user with 260 edits. Account created on 13 March 2024.
Jump to navigation Jump to search
Search for contributionsExpandCollapse
⧼contribs-top⧽
⧼contribs-date⧽
(newest | oldest) View ( | ) (20 | 50 | 100 | 250 | 500)

15 March 2024

14 March 2024

  • 16:2416:24, 14 March 2024 diff hist +14,107 N ExTaxonomyCreated page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa..."
  • 16:2116:21, 14 March 2024 diff hist +3,177 N ExTaxonomy-AnswersCreated page with "=Answers to the Taxonomy exercise= Answers by: Rasmus Wernersson ==Question 1:== === a)=== Quite a lot extinct groups are encountered along the way - this is marked by a small cross-shaped icon next to the group. Many of these groups do not have a page dedicated to them but are there for putting the taxonomical placement of modern groups into context. A good example of an "important" extinct group which has a dedicated page is "[http://www.tolweb...."
  • 16:1916:19, 14 March 2024 diff hist +13,052 N ExJEditCreated page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC..." current
  • 16:1716:17, 14 March 2024 diff hist +5,230 N ExJEdit-AnswersCreated page with "=Answer to the JEdit exercise= '''Notice:''' here the answers are written in text-only format, to illustrate what answers can look like written in JEdit. EXERCISE: jEdit ---------------- Answers by: Rasmus Wernersson (v18103) Question 1: ----------- The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newli..." current

13 March 2024

(newest | oldest) View ( | ) (20 | 50 | 100 | 250 | 500)