All public logs

Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

09:43, 15 March 2024 WikiSysop talk contribs created page ExPairwiseAlignment-AnswersEng (Created page with "'''Answers to pairwise alignment exercise (English version)''' * The exercise itself is here: ExPairwiseAlignment * The Danish version of the answers is here: ExPairwiseAlignment-Answers == Part 0== ===Q0=== Yes, the matrix has the same values in the cells as the one from the lecture. Image:Interactive_NW_example.png == Part 1== ===Q1=== FASTA format. ===Q2=== # Length: 361 # Identity: 176/361 (48.8%) # Similarity: 214/361 (59.3%) # Gaps: 92/36...")
09:42, 15 March 2024 WikiSysop talk contribs created page ExUniProt-answers (Created page with " The numbers are found using UniProt Beta on Sep 12, 2022 ==Simple text mining== '''QUESTION 1.1:''' # How many hits do you find? 4,796 # How many of these hits are from Swiss-Prot? 1,667 # Can you identify the correct hit (''i.e.'' see which one is actually human insulin and not something else)? It's P01308 / INS_HUMAN (not the top hit, but still on the first page). '''QUESTION 1.2:''' How many hits are now left? How many of these are from Swiss-Prot? <b...")
09:42, 15 March 2024 WikiSysop talk contribs created page ExTranslation-answers (Created page with "Answers by: Francisco Roque and Nils Weinhold (Some editing by Rasmus Wernersson and Henrik Nielsen) ==Step 1: Basic translation== '''QUESTION 1:''' # How is a STOP codon displayed? <tt>***</tt> # How is a START codon displayed? <tt>>>></tt> (Strict, ''i.e.'' "ATG") <tt>)))</tt> (Alternative, ''i.e.'' "TTG" and "CTG") # Does a start-codon always code for Methionine (M)? Yes - but only if it's actually used as a start codon (see the Instructions tab...")
09:40, 15 March 2024 WikiSysop talk contribs created page ExGenbank-new-answers (Created page with "Note: numbers in Part 2 and Part 3 are updated on September 6, 2023. == Part 1 == ;QUESTION 1.1: :a) Inspecting the FEATURE table of the entry reveals that two CDS regions are defined; therefore there are two genes in this entry. As stated on the GenBank hand-out "CDS" is the most stable definition of a protein coding gene used in the GenBank format - sometimes "gene" will also be present, but CDS is more commonly used. :b) ''Columba livia'' (Rock pigeon / domestic pig...")
15:24, 14 March 2024 WikiSysop talk contribs created page ExTaxonomy (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa...")
15:21, 14 March 2024 WikiSysop talk contribs created page ExTaxonomy-Answers (Created page with "=Answers to the Taxonomy exercise= Answers by: Rasmus Wernersson ==Question 1:== === a)=== Quite a lot extinct groups are encountered along the way - this is marked by a small cross-shaped icon next to the group. Many of these groups do not have a page dedicated to them but are there for putting the taxonomical placement of modern groups into context. A good example of an "important" extinct group which has a dedicated page is "[http://www.tolweb....")
15:19, 14 March 2024 WikiSysop talk contribs created page ExJEdit (Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC...")
15:17, 14 March 2024 WikiSysop talk contribs created page ExJEdit-Answers (Created page with "=Answer to the JEdit exercise= '''Notice:''' here the answers are written in text-only format, to illustrate what answers can look like written in JEdit. EXERCISE: jEdit ---------------- Answers by: Rasmus Wernersson (v18103) Question 1: ----------- The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newli...")
17:12, 13 March 2024 WikiSysop talk contribs created page BLOSUM matrix examples (Created page with "==BLOSUM 30== <pre> A B C D E F G H I K L M N P Q R S T V W X Y Z * A 4 0 -3 0 0 -2 0 -2 0 0 -1 1 0 -1 1 -1 1 1 1 -5 0 -4 0 -7 B 0 5 -2 5 0 -3 0 -2 -2 0 -1 -2 4 -2 -1 -2 0 0 -2 -5 -1 -3 0 -7 C -3 -2 17 -3 1 -3 -4 -5 -2 -3 0 -2 -1 -3 -2 -2 -2 -2 -2 -2 -2 -6 0 -7 D 0 5 -3 9 1 -5 -1 -2 -4 0 -1 -3 1 -1 -1 -1 0 -1 -2 -4 -1 -1 0 -7 E 0 0 1 1 6 -4 -2 0 -3 2 -1 -1 -1 1 2 -1 0 -2 -3 -1 -1 -2 5 -7 F -2...")
17:11, 13 March 2024 WikiSysop talk contribs created page File:BLOSUM62 zoom.png
17:11, 13 March 2024 WikiSysop talk contribs uploaded File:BLOSUM62 zoom.png
17:10, 13 March 2024 WikiSysop talk contribs created page File:PairwiseAlignment.png
17:10, 13 March 2024 WikiSysop talk contribs uploaded File:PairwiseAlignment.png
17:09, 13 March 2024 WikiSysop talk contribs created page ExPairwiseAlignment (Created page with "'''Exercise written by:''' [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson], with modifications by Anne Bresciani, Ulrich Johan Kudahl, Anders Gorm Pedersen and Henrik Nielsen. ==Introduction== In this exercise we will be working with '''pairwise alignment''' of protein sequences. As explained in today's lecture, pairwise alignment is performed using an algorithm known as Dynamic Programming (DP). In this...")
17:05, 13 March 2024 WikiSysop talk contribs created page File:Uniprotlogo.gif
17:05, 13 March 2024 WikiSysop talk contribs uploaded File:Uniprotlogo.gif
17:04, 13 March 2024 WikiSysop talk contribs created page File:Download.png
17:04, 13 March 2024 WikiSysop talk contribs uploaded File:Download.png
17:03, 13 March 2024 WikiSysop talk contribs created page Exercise: The protein database UniProt (Created page with "Exercise written by: Henrik Nielsen - updated by Morten Nielsen and Rasmus Wernersson right|frame|UniProt logo as of 2010 - source: http://www.uniprot.org __TOC__ In this exercise, we shall extract information from the protein database, Uniprot. This database is administrated in collaboration between [http://www.isb-sib.ch/ Swiss Institute of Bioinformatics (SIB)], [http://www.ebi.ac.uk/ European Bioinformatics Institute (EBI)], England, and [ht...")
17:02, 13 March 2024 WikiSysop talk contribs created page Exercise: Translation - Virtual Ribosome (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] In this exercise we will be using ''Virtual Ribosome'' - a software that provides a series of functions to '''translate DNA to protein sequences'''. Besides using the simple functions to translate DNA using a known reading frame, we shall work on computer-based analysis of possible reading frames, location of START and STOP codons etc....")
16:54, 13 March 2024 WikiSysop talk contribs created page File:Cogs brain.png
16:54, 13 March 2024 WikiSysop talk contribs uploaded File:Cogs brain.png
16:53, 13 March 2024 WikiSysop talk contribs created page File:T044680.gif
16:53, 13 March 2024 WikiSysop talk contribs uploaded File:T044680.gif
16:52, 13 March 2024 WikiSysop talk contribs created page File:Keys1a.png
16:52, 13 March 2024 WikiSysop talk contribs uploaded File:Keys1a.png
16:51, 13 March 2024 WikiSysop talk contribs created page File:NCBI-nucleotide.png
16:51, 13 March 2024 WikiSysop talk contribs uploaded File:NCBI-nucleotide.png
16:48, 13 March 2024 WikiSysop talk contribs created page ExGenbank-new (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] and Henrik Nielsen ==Introduction== This exercise has two main goals: '''1)''' Introduction to the types of DNA data contained in the GenBank database (data format, visualization, cross-database links, how biological "features" such as genes are annotated and described as coordinates in the DNA sequence). '''2)''' Practice searching th...")
16:47, 13 March 2024 WikiSysop talk contribs created page File:Phone 34.gif
16:47, 13 March 2024 WikiSysop talk contribs uploaded File:Phone 34.gif
16:28, 13 March 2024 WikiSysop talk contribs created page File:FishNCBI-edited-phy.png
16:28, 13 March 2024 WikiSysop talk contribs uploaded File:FishNCBI-edited-phy.png
16:27, 13 March 2024 WikiSysop talk contribs created page File:Zebrafisch.jpg
16:27, 13 March 2024 WikiSysop talk contribs uploaded File:Zebrafisch.jpg
16:27, 13 March 2024 WikiSysop talk contribs created page File:Fruitfly.jpg
16:27, 13 March 2024 WikiSysop talk contribs uploaded File:Fruitfly.jpg
16:26, 13 March 2024 WikiSysop talk contribs created page File:Taxonomylogo.gif
16:26, 13 March 2024 WikiSysop talk contribs uploaded File:Taxonomylogo.gif
16:26, 13 March 2024 WikiSysop talk contribs created page File:Tyrannosaurus+Chicken Rey.jpg
16:26, 13 March 2024 WikiSysop talk contribs uploaded File:Tyrannosaurus+Chicken Rey.jpg
16:25, 13 March 2024 WikiSysop talk contribs created page File:Scrofaguide.png
16:25, 13 March 2024 WikiSysop talk contribs uploaded File:Scrofaguide.png
16:24, 13 March 2024 WikiSysop talk contribs created page File:Toloverview.jpg
16:24, 13 March 2024 WikiSysop talk contribs uploaded File:Toloverview.jpg
16:23, 13 March 2024 WikiSysop talk contribs created page File:ApesTax 600.png
16:23, 13 March 2024 WikiSysop talk contribs uploaded File:ApesTax 600.png
16:22, 13 March 2024 WikiSysop talk contribs created page Taxonomy databases (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa...")
16:13, 13 March 2024 WikiSysop talk contribs created page File:Phylo6.png
16:13, 13 March 2024 WikiSysop talk contribs uploaded File:Phylo6.png

All public logs

Navigation menu

Search