All public logs
Jump to navigation
Jump to search
Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 16:36, 13 March 2024 WikiSysop talk contribs uploaded File:SelecetionNormal.png
- 16:35, 13 March 2024 WikiSysop talk contribs created page File:Mac Finder icon.png
- 16:35, 13 March 2024 WikiSysop talk contribs uploaded File:Mac Finder icon.png
- 16:35, 13 March 2024 WikiSysop talk contribs created page File:JEdit screenshot.png
- 16:35, 13 March 2024 WikiSysop talk contribs uploaded File:JEdit screenshot.png
- 16:34, 13 March 2024 WikiSysop talk contribs created page Plain text files and jEdit (Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC...")
- 16:33, 13 March 2024 WikiSysop talk contribs created page File:Geany rectangular selection cropped.png
- 16:33, 13 March 2024 WikiSysop talk contribs uploaded File:Geany rectangular selection cropped.png
- 16:32, 13 March 2024 WikiSysop talk contribs created page File:Geany normal selection cropped.png
- 16:32, 13 March 2024 WikiSysop talk contribs uploaded File:Geany normal selection cropped.png
- 16:28, 13 March 2024 WikiSysop talk contribs created page File:Geany sequence.gb cropped.png
- 16:28, 13 March 2024 WikiSysop talk contribs uploaded File:Geany sequence.gb cropped.png
- 16:28, 13 March 2024 WikiSysop talk contribs created page File:Ascii1.png
- 16:28, 13 March 2024 WikiSysop talk contribs uploaded File:Ascii1.png
- 16:27, 13 March 2024 WikiSysop talk contribs created page File:WordFormat small.png
- 16:27, 13 March 2024 WikiSysop talk contribs uploaded File:WordFormat small.png
- 16:25, 13 March 2024 WikiSysop talk contribs created page Plain text files and Geany (Created page with "Adapted from the exercise Plain text files and jEdit (originally written by [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson]) by [https://www.dtu.dk/person/henrik-nielsen?id=25617 Henrik Nielsen]. == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTC...")
- 16:23, 13 March 2024 WikiSysop talk contribs created page 22111:Course plan autumn 2023 (Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Aug 29 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 33''', and the exercises will then take place in '''building 210, rooms 142+148+162+168'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik...")
- 16:22, 13 March 2024 WikiSysop talk contribs created page 22111 - Introduction to Bioinformatics (Created page with "'''Formerly known as 36611 and 27611''' == Practical information == DTU's Studies Handbook about [http://www.kurser.dtu.dk/course/22111 #22111] This course is '''taught in English from 2019''' (previously taught in Danish), and it is a practically oriented, introductory 3rd semester (previously 4th semester) course. All students from DTU and other universities are welcome. For more information, please contact: Associate Professor [http://www.dtu.dk/service/telefonbog/...")
- 16:22, 13 March 2024 WikiSysop talk contribs created page MediaWiki:Sidebar (Created page with " * navigation ** https://teaching.healthtech.dtu.dk/|Course List ** https://teaching.healthtech.dtu.dk/22111/|Course 22111 * TOOLBOX")
- 16:20, 13 March 2024 WikiSysop talk contribs created page MediaWiki:Mainpage (Created page with "22111 - Introduction to Bioinformatics")
- 16:17, 13 March 2024 WikiSysop talk contribs created page MediaWiki:Disclaimers (Created blank page)
- 16:16, 13 March 2024 WikiSysop talk contribs created page MediaWiki:Aboutsite (Created blank page)
- 16:16, 13 March 2024 WikiSysop talk contribs created page MediaWiki:Privacy (Created blank page)
- 16:11, 13 March 2024 MediaWiki default talk contribs created page Main Page