All public logs

Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

• 12:06, 23 August 2024 User account Carol talk contribs was created by WikiSysop talk contribs
• 09:08, 5 July 2024 User account Raz talk contribs was created by WikiSysop talk contribs
• 15:50, 24 June 2024 User account Henni talk contribs was created by WikiSysop talk contribs
• 17:43, 15 March 2024 WikiSysop talk contribs created page File:NCBI BALST select seq.png
• 17:43, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI BALST select seq.png
• 17:42, 15 March 2024 WikiSysop talk contribs created page File:Blastn cropped+circle.png
• 17:42, 15 March 2024 WikiSysop talk contribs uploaded File:Blastn cropped+circle.png
• 17:41, 15 March 2024 WikiSysop talk contribs created page Exercise: BLAST (Created page with "Exercise written by [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] and modified by Henrik Nielsen. ==Introduction== In this exercise we will be using BLAST ('''B'''asic '''L'''ocal '''A'''lignment '''S'''earch '''T'''ool) for searching sequence databases such as GenBank (DNA data) and UniProt (protein). When using BLAST for sequence searches it is of utmost importance to be able to critically evaluate t...")
• 12:50, 15 March 2024 WikiSysop talk contribs created page Bioinformatics in practice, Faroe Islands 2022 (Created page with "This is the home page for week 44+45 of the "Bioinformatics in practice" course, Faroe Islands 2022. These five days are taught by [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] and [https://globe.ku.dk/staff-list/hologenomics/?id=271131&vis=medarbejder Bent Petersen]. == Wednesday November 2 == === Morning: Introduction, plain text files and taxonomy databases === '''Lectures:''' * ''[https://teaching.he...")
• 12:49, 15 March 2024 WikiSysop talk contribs created page 27611: Kursusplan for forår 2017 (Created page with "'''NB:''' Dette er en ''foreløbig'' kursusplan; ændringer kan forekomme! ==Generel information== ===Undervisere / forelæsere=== * [http://www.cbs.dtu.dk/staff/show-staff.php?id=535 Henrik Nielsen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/staff/show-staff.php?id=758 Bent Petersen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/~raz/ Rasmus Wernersson] — Ekstern lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/staff/show-staff.php...")
• 12:49, 15 March 2024 WikiSysop talk contribs created page 22111:Kursusplan for forår 2018 (Created page with "<!-- '''NB:''' Dette er en ''foreløbig'' kursusplan; ændringer kan forekomme! --> ==Generel information== ===Undervisere / forelæsere=== * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] — Lektor, kursusansvarlig. * [http://www.dtu.dk/service/telefonbog/person?id=21811&cpid=214076&tab=1 Bent Petersen] — Lektor, kursusansvarlig. * [http://www.cbs.dtu.dk/~raz/ Rasmus Wernersson] — Ekste...")
• 12:48, 15 March 2024 WikiSysop talk contribs created page 22111:Course plan spring 2019 (Created page with "== General information == === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=214126&tab=2&qt=dtupublicationquery Henrik Nielsen] — Associate professor, course responsible. * [https://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] — External associate professor, course responsible. * [http://www.dtu.dk/service/telefonbog/person?id=34983&cpid=214024&tab=2&qt=dtupublicationqu...")
• 12:47, 15 March 2024 WikiSysop talk contribs created page 22111:Course plan spring 2020 (Created page with "== General information == === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik Nielsen] — Associate professor, course responsible. * [https://www.dtu.dk/service/telefonbog/person?id=18103&tab=2&qt=dtupublicationquery Rasmus Wernersson] — External associate professor, course responsible. * [http://www.dtu.dk/service/telefonbog/person?id=34983&tab=2&qt=dtupublicationquery Paolo Marcatili] &md...")
• 12:47, 15 March 2024 WikiSysop talk contribs created page 22111:Course plan spring 2021 (Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Feb 2 at 13:00'''. '''In 2021, the course will be held online during the entire semester.''' <!-- Depending on the development in the Corona situation, we may later switch to physical presence. The information here will be updated, as soon as we know more. --> For online lectures and exercises, we use Mi...")
• 12:45, 15 March 2024 WikiSysop talk contribs created page 22111:Course plan spring 2022 (Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Feb 1 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 32''', and the exercises will then take place in '''building 210, rooms 142+148 and 112+118'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery He...")
• 12:41, 15 March 2024 WikiSysop talk contribs created page 22111:Course plan autumn 2022 (Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Aug 30 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 32''', and the exercises will then take place in '''building 210, rooms 112+118, 142+148, and 162'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationqu...")
• 12:36, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34-NJ tree.annotated-iTOL.png
• 12:36, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34-NJ tree.annotated-iTOL.png
• 12:36, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34-NJ tree.rerooted-iTOL.png
• 12:36, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34-NJ tree.rerooted-iTOL.png
• 12:36, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34-NJ tree.rerooted-Seaview.png
• 12:36, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34-NJ tree.rerooted-Seaview.png
• 12:35, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34-NJ tree.unrooted.png
• 12:35, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34-NJ tree.unrooted.png
• 12:34, 15 March 2024 WikiSysop talk contribs created page File:L18 Common Taxonomy Tree.png
• 12:34, 15 March 2024 WikiSysop talk contribs uploaded File:L18 Common Taxonomy Tree.png
• 12:34, 15 March 2024 WikiSysop talk contribs created page File:L18 CDS-NJ tree.revtrans.wgaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs uploaded File:L18 CDS-NJ tree.revtrans.wgaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs created page File:L18 CDS-NJ tree.revtrans.nogaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs uploaded File:L18 CDS-NJ tree.revtrans.nogaps.png
• 12:33, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.swapped.png
• 12:33, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.swapped.png
• 12:33, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.unrooted.png
• 12:33, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.unrooted.png
• 12:32, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.png
• 12:32, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.png
• 12:27, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny - Answers (Seaview version) (Created page with "== Step 1 == Here is a PDF with the aligned sequences. ==Step 2== Here is the text file with the pairwise distances. It is clear that the sequence HTLV shows larger distances than all the other sequences, with all distances being above 0.7. ==Step3== Here is a picture of the NJ tree: File:Pol21-NJ_tree.png The longest branch is the one leading to HTLV, which is in good agreement with the observation in the prev...")
• 12:25, 15 March 2024 WikiSysop talk contribs created page File:EPB4.1 human.mafft.fasta.png
• 12:25, 15 March 2024 WikiSysop talk contribs uploaded File:EPB4.1 human.mafft.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs created page File:EPB4.1 human.clustalo.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs uploaded File:EPB4.1 human.clustalo.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q5.png
• 12:24, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q5.png
• 12:23, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q2-tree.png
• 12:23, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q2-tree.png
• 12:23, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q2-aligned.png
• 12:23, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q2-aligned.png
• 12:22, 15 March 2024 WikiSysop talk contribs created page Exercise: Multiple Alignments Answers (Seaview version) (Created page with " By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAG AGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACC CTGTCAACTTCAAG...")
• 12:19, 15 March 2024 WikiSysop talk contribs created page ExGeany-Answers (Created page with "=Answers to the exercise in Plain text files and Geany= Answers by: Rasmus Wernersson and Henrik Nielsen == Question 1:== The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newlines actually consists of two bytes (CR + LF), whereas UNIX and the old Mac standard only use one byte. The 8 byte difference corresponds to the 8 lines of te...")
• 12:14, 15 March 2024 WikiSysop talk contribs created page ExBlast-Answers2 (Created page with "Answers to the BLAST exercise, by Henrik Nielsen. Values for database sizes etc. retrieved March 7, 2020 ==Part 1: Your first BLAST search== ===QUESTION 1.1=== * ''what is the identifier (Accession)?'' :OL351605 or M57671 (Note that the latter was also part of the sequence name for your query sequence!) * ''what is the alignment score ("Max score in bits")?'' :The max score is 780 bits (Raw score is 864) * ''what is the percent identity and query coverage?'' :100% * '...")