All public logs

Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

• 12:34, 15 March 2024 WikiSysop talk contribs created page File:L18 CDS-NJ tree.revtrans.wgaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs uploaded File:L18 CDS-NJ tree.revtrans.wgaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs created page File:L18 CDS-NJ tree.revtrans.nogaps.png
• 12:34, 15 March 2024 WikiSysop talk contribs uploaded File:L18 CDS-NJ tree.revtrans.nogaps.png
• 12:33, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.swapped.png
• 12:33, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.swapped.png
• 12:33, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.unrooted.png
• 12:33, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.unrooted.png
• 12:32, 15 March 2024 WikiSysop talk contribs created page File:Pol21-NJ tree.png
• 12:32, 15 March 2024 WikiSysop talk contribs uploaded File:Pol21-NJ tree.png
• 12:27, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny - Answers (Seaview version) (Created page with "== Step 1 == Here is a PDF with the aligned sequences. ==Step 2== Here is the text file with the pairwise distances. It is clear that the sequence HTLV shows larger distances than all the other sequences, with all distances being above 0.7. ==Step3== Here is a picture of the NJ tree: File:Pol21-NJ_tree.png The longest branch is the one leading to HTLV, which is in good agreement with the observation in the prev...")
• 12:25, 15 March 2024 WikiSysop talk contribs created page File:EPB4.1 human.mafft.fasta.png
• 12:25, 15 March 2024 WikiSysop talk contribs uploaded File:EPB4.1 human.mafft.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs created page File:EPB4.1 human.clustalo.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs uploaded File:EPB4.1 human.clustalo.fasta.png
• 12:24, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q5.png
• 12:24, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q5.png
• 12:23, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q2-tree.png
• 12:23, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q2-tree.png
• 12:23, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q2-aligned.png
• 12:23, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q2-aligned.png
• 12:22, 15 March 2024 WikiSysop talk contribs created page Exercise: Multiple Alignments Answers (Seaview version) (Created page with " By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGCAACGCTGTCAAG AGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCAGCGACCTGCATGCCTACAACCTGCGTGTCGACC CTGTCAACTTCAAG...")
• 12:19, 15 March 2024 WikiSysop talk contribs created page ExGeany-Answers (Created page with "=Answers to the exercise in Plain text files and Geany= Answers by: Rasmus Wernersson and Henrik Nielsen == Question 1:== The file sizes are: 453 bytes: alpha_globin_OldMac.fsa 453 bytes: alpha_globin_Unix.fsa 461 bytes: alpha_globin_Windows.fsa The important thing to notice here is that DOS/Windows newlines actually consists of two bytes (CR + LF), whereas UNIX and the old Mac standard only use one byte. The 8 byte difference corresponds to the 8 lines of te...")
• 12:14, 15 March 2024 WikiSysop talk contribs created page ExBlast-Answers2 (Created page with "Answers to the BLAST exercise, by Henrik Nielsen. Values for database sizes etc. retrieved March 7, 2020 ==Part 1: Your first BLAST search== ===QUESTION 1.1=== * ''what is the identifier (Accession)?'' :OL351605 or M57671 (Note that the latter was also part of the sequence name for your query sequence!) * ''what is the alignment score ("Max score in bits")?'' :The max score is 780 bits (Raw score is 864) * ''what is the percent identity and query coverage?'' :100% * '...")
• 11:51, 15 March 2024 WikiSysop talk contribs created page File:Gaps-2014-1g.JPG
• 11:51, 15 March 2024 WikiSysop talk contribs uploaded File:Gaps-2014-1g.JPG
• 11:50, 15 March 2024 WikiSysop talk contribs created page FAQ (Created page with "== Practical information == === Exam === * ''How do I find out where and when the exam is held?'' At http://www.eksamensplan.dtu.dk/ . * ''Which online platform will you use for the exam?'' This year we will be using Digital Exam (the new interface) which is accessed via https://eksamen.dtu.dk/ . We will ''not'' be using the old interface via http://onlineeksamen.dtu.dk/ . <!-- === COVID-19 information 2021 === This year, the written exam will be a '''home exam'''....")
• 11:48, 15 March 2024 WikiSysop talk contribs created page Link collection (Created page with "== Taxonomy == ;Tree of Life http://www.tolweb.org/ :(Good descriptive Taxonomy database — limited range of organisms). ;NCBI Taxonomy http://www.ncbi.nlm.nih.gov/Taxonomy/ :(Somewhat "technical" but very exhaustive taxonomical database. TaxIDs are also used in GenBank and UniProt). : The "Common Tree" function can be used to investigate how closely related two or more organisms are: http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi : NCBI search with "Toke...")
• 11:42, 15 March 2024 WikiSysop talk contribs created page Checklist for computers (Created page with "At the exam in Introduction to Bioinformatics, you are going to use the same resources (web-servers and programs) that you used for the exercises — if your computer has worked fine for all the exercises, it will also work fine for the exam. == Hardware == ; A laptop. : It makes no difference whether you use Windows, Mac, or Linux, as long as you have the listed software. However, an iPad, an Android tablet, or a Chromebook will NOT be enough for the exam. ; A mouse. :...")
• 11:33, 15 March 2024 WikiSysop talk contribs created page ExMulAlign-Answers (Created page with "Click here for English version. =Svar til Multiple Alignment øvelsen= Af: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Spørgsmål 1== Fasta fil: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTT...")
• 11:30, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34.newick.txt.png
• 11:30, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34.newick.txt.png
• 11:29, 15 March 2024 WikiSysop talk contribs created page File:NCBI-common-tree.png
• 11:29, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI-common-tree.png
• 11:28, 15 March 2024 WikiSysop talk contribs created page File:Salmon frog.png
• 11:28, 15 March 2024 WikiSysop talk contribs uploaded File:Salmon frog.png
• 11:28, 15 March 2024 WikiSysop talk contribs created page File:Mafft tree.png
• 11:28, 15 March 2024 WikiSysop talk contribs uploaded File:Mafft tree.png
• 11:25, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny-Answers (Created page with "== Answers to the Phylogeny exercise == === Step 8 === Answers to "The Phylogeny of HIV" can be found [https://teaching.healthtech.dtu.dk/material/36611/files/binfintro/hiv_origin.html here]. <!-- http://www.cbs.dtu.dk/courses/biosys/binfintro/hiv_origin.php --> === Step 9 === * How did you construct the tree? (alignment method, construction of tree, outgroup etc. ) For starters you need to do a multiple alignment of your sequences. A number o...")
• 11:22, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny (Seaview version) (Created page with "Before you start: please make sure you have the Seaview program installed on your computer. If not, see the Multiple alignment exercise. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodefici...")
• 11:14, 15 March 2024 WikiSysop talk contribs created page File:Q7-MAFFT.png
• 11:14, 15 March 2024 WikiSysop talk contribs uploaded File:Q7-MAFFT.png
• 11:13, 15 March 2024 WikiSysop talk contribs created page File:Jalview Q2c.png
• 11:13, 15 March 2024 WikiSysop talk contribs uploaded File:Jalview Q2c.png
• 11:12, 15 March 2024 WikiSysop talk contribs created page ExMulAlign-Answers-English (Created page with "Click here for Danish version. =Answers to the Multiple Alignment exercise= By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGC...")
• 11:06, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q1-unaligned.png
• 11:06, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q1-unaligned.png
• 11:04, 15 March 2024 WikiSysop talk contribs created page Exercise: Multiple Alignments (Seaview version) (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]; transcribed to use Seaview by [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik Nielsen]. ==Step 0 — installing Seaview == In this exercise, we a...")
• 11:03, 15 March 2024 WikiSysop talk contribs created page ExPSIBLAST answer (Created page with "Note: E-values etc. are found November 8, 2023. == When BLAST fails == * '''QUESTION 1''': How many significant hits does BLAST find (E-value < 0.005)? Answer: No sequences with E-value below 0.005. ==Trying another approach== * '''QUESTION 2''': How many significant hits does BLAST find (E-value < 0.005)? Answer: After the first iteration, 363 hits are found. * '''QUESTION 3''': How large a fraction of the query sequence do the significant hits match (excluding the...")
• 11:00, 15 March 2024 WikiSysop talk contribs created page File:Psiblastp nr.png