User contributions for WikiSysop
Jump to navigation
Jump to search
13 March 2024
- 17:4317:43, 13 March 2024 diff hist −2 22111:Course plan autumn 2023 →Tuesday Sep 5 — GenBank
- 17:3517:35, 13 March 2024 diff hist +210 22111:Course plan autumn 2023 →Tuesday Sep 5 — GenBank
- 17:3117:31, 13 March 2024 diff hist +42 22111:Course plan autumn 2023 →Tuesday Aug 29 — Introduction & taxonomy
- 17:2817:28, 13 March 2024 diff hist 0 N File:FishNCBI-edited-phy.png No edit summary current
- 17:2717:27, 13 March 2024 diff hist 0 N File:Zebrafisch.jpg No edit summary current
- 17:2717:27, 13 March 2024 diff hist 0 N File:Fruitfly.jpg No edit summary current
- 17:2617:26, 13 March 2024 diff hist 0 N File:Taxonomylogo.gif No edit summary current
- 17:2617:26, 13 March 2024 diff hist 0 N File:Tyrannosaurus+Chicken Rey.jpg No edit summary current
- 17:2517:25, 13 March 2024 diff hist 0 N File:Scrofaguide.png No edit summary current
- 17:2417:24, 13 March 2024 diff hist 0 N File:Toloverview.jpg No edit summary current
- 17:2317:23, 13 March 2024 diff hist 0 N File:ApesTax 600.png No edit summary current
- 17:2217:22, 13 March 2024 diff hist +14,107 N Taxonomy databases Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa..." current
- 17:2117:21, 13 March 2024 diff hist 0 22111:Course plan autumn 2023 →Tuesday Aug 29 — Introduction & taxonomy
- 17:1417:14, 13 March 2024 diff hist +42 Exercise: Phylogeny →Time to try on your own! current
- 17:1317:13, 13 March 2024 diff hist 0 N File:Phylo6.png No edit summary current
- 17:1217:12, 13 March 2024 diff hist 0 N File:Phylo5.png No edit summary current
- 17:1217:12, 13 March 2024 diff hist 0 N File:Phylo4.png No edit summary current
- 17:1117:11, 13 March 2024 diff hist 0 N File:Treehugger2.png No edit summary current
- 17:1117:11, 13 March 2024 diff hist 0 N File:Treehugger1.png No edit summary current
- 17:0917:09, 13 March 2024 diff hist +2 Exercise: Phylogeny →Step 2
- 17:0917:09, 13 March 2024 diff hist 0 N File:Mafft download.png No edit summary current
- 17:0817:08, 13 March 2024 diff hist +10 Exercise: Phylogeny →The Phylogeny of HIV
- 17:0717:07, 13 March 2024 diff hist +42 Exercise: Phylogeny →The Phylogeny of HIV
- 17:0617:06, 13 March 2024 diff hist +8,116 N Exercise: Phylogeny Created page with "Before you start: please install the [http://tree.bio.ed.ac.uk/software/figtree/ FigTree viewer] on your computer. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodeficiency Virus two (HIV-2). HIV-1 is responsible for the global pandemic, whil..."
- 17:0417:04, 13 March 2024 diff hist −16 Exercise: Multiple Alignments (English version) →Step 3 current
- 17:0417:04, 13 March 2024 diff hist +2 Exercise: Multiple Alignments (English version) →Step 8
- 17:0317:03, 13 March 2024 diff hist +42 Exercise: Multiple Alignments (English version) →Step 8
- 16:5916:59, 13 March 2024 diff hist +1 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 16:5816:58, 13 March 2024 diff hist −1 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 16:5616:56, 13 March 2024 diff hist +2 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 16:5616:56, 13 March 2024 diff hist +83 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 16:5216:52, 13 March 2024 diff hist 0 N File:SpliceForms raz cropped.png No edit summary current
- 16:5016:50, 13 March 2024 diff hist +42 Exercise: Multiple Alignments (English version) →Step 4
- 16:4716:47, 13 March 2024 diff hist +6 Exercise: Multiple Alignments (English version) →Step 1
- 16:4716:47, 13 March 2024 diff hist +36 Exercise: Multiple Alignments (English version) →Step 1
- 16:4216:42, 13 March 2024 diff hist 0 N File:JalView DNA1.png No edit summary current
- 16:4116:41, 13 March 2024 diff hist 0 N File:Emblem-important tiny.png No edit summary current
- 16:4016:40, 13 March 2024 diff hist 0 N File:Office-notes-line drawing.png No edit summary current
- 16:3916:39, 13 March 2024 diff hist +20,953 N Exercise: Multiple Alignments (English version) Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with some editing by Henrik Nielsen and an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]. <!-- Click here for Danish version. --> ==Step 0 - installing Jalview == Go to https://www.jalview.org/, click the green downward..."
- 16:3716:37, 13 March 2024 diff hist 0 N File:SelecetionBlock.png No edit summary current
- 16:3616:36, 13 March 2024 diff hist 0 N File:SelecetionNormal.png No edit summary current
- 16:3616:36, 13 March 2024 diff hist 0 Plain text files and jEdit →Taking jEdit for a test run current
- 16:3516:35, 13 March 2024 diff hist 0 N File:Mac Finder icon.png No edit summary current
- 16:3516:35, 13 March 2024 diff hist 0 N File:JEdit screenshot.png No edit summary current
- 16:3416:34, 13 March 2024 diff hist +13,052 N Plain text files and jEdit Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC..."
- 16:3316:33, 13 March 2024 diff hist 0 N File:Geany rectangular selection cropped.png No edit summary current
- 16:3216:32, 13 March 2024 diff hist 0 N File:Geany normal selection cropped.png No edit summary current
- 16:3116:31, 13 March 2024 diff hist 0 Plain text files and Geany →Taking Geany for a test run
- 16:3016:30, 13 March 2024 diff hist 0 Plain text files and Geany →Taking Geany for a test run
- 16:2816:28, 13 March 2024 diff hist 0 N File:Geany sequence.gb cropped.png No edit summary current
