User contributions for WikiSysop

13 March 2024

• 16:4316:43, 13 March 2024 diff hist −2‎ 22111:Course plan autumn 2023 ‎ →‎Tuesday Sep 5 — GenBank
• 16:3516:35, 13 March 2024 diff hist +210‎ 22111:Course plan autumn 2023 ‎ →‎Tuesday Sep 5 — GenBank
• 16:3116:31, 13 March 2024 diff hist +42‎ 22111:Course plan autumn 2023 ‎ →‎Tuesday Aug 29 — Introduction & taxonomy
• 16:2816:28, 13 March 2024 diff hist 0‎ N File:FishNCBI-edited-phy.png ‎No edit summary current
• 16:2716:27, 13 March 2024 diff hist 0‎ N File:Zebrafisch.jpg ‎No edit summary current
• 16:2716:27, 13 March 2024 diff hist 0‎ N File:Fruitfly.jpg ‎No edit summary current
• 16:2616:26, 13 March 2024 diff hist 0‎ N File:Taxonomylogo.gif ‎No edit summary current
• 16:2616:26, 13 March 2024 diff hist 0‎ N File:Tyrannosaurus+Chicken Rey.jpg ‎No edit summary current
• 16:2516:25, 13 March 2024 diff hist 0‎ N File:Scrofaguide.png ‎No edit summary current
• 16:2416:24, 13 March 2024 diff hist 0‎ N File:Toloverview.jpg ‎No edit summary current
• 16:2316:23, 13 March 2024 diff hist 0‎ N File:ApesTax 600.png ‎No edit summary current
• 16:2216:22, 13 March 2024 diff hist +14,107‎ N Taxonomy databases ‎ Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa..." current
• 16:2116:21, 13 March 2024 diff hist 0‎ 22111:Course plan autumn 2023 ‎ →‎Tuesday Aug 29 — Introduction & taxonomy
• 16:1416:14, 13 March 2024 diff hist +42‎ Exercise: Phylogeny ‎ →‎Time to try on your own! current
• 16:1316:13, 13 March 2024 diff hist 0‎ N File:Phylo6.png ‎No edit summary current
• 16:1216:12, 13 March 2024 diff hist 0‎ N File:Phylo5.png ‎No edit summary current
• 16:1216:12, 13 March 2024 diff hist 0‎ N File:Phylo4.png ‎No edit summary current
• 16:1116:11, 13 March 2024 diff hist 0‎ N File:Treehugger2.png ‎No edit summary current
• 16:1116:11, 13 March 2024 diff hist 0‎ N File:Treehugger1.png ‎No edit summary current
• 16:0916:09, 13 March 2024 diff hist +2‎ Exercise: Phylogeny ‎ →‎Step 2
• 16:0916:09, 13 March 2024 diff hist 0‎ N File:Mafft download.png ‎No edit summary current
• 16:0816:08, 13 March 2024 diff hist +10‎ Exercise: Phylogeny ‎ →‎The Phylogeny of HIV
• 16:0716:07, 13 March 2024 diff hist +42‎ Exercise: Phylogeny ‎ →‎The Phylogeny of HIV
• 16:0616:06, 13 March 2024 diff hist +8,116‎ N Exercise: Phylogeny ‎ Created page with "Before you start: please install the [http://tree.bio.ed.ac.uk/software/figtree/ FigTree viewer] on your computer. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodeficiency Virus two (HIV-2). HIV-1 is responsible for the global pandemic, whil..."
• 16:0416:04, 13 March 2024 diff hist −16‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 3 current
• 16:0416:04, 13 March 2024 diff hist +2‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 8
• 16:0316:03, 13 March 2024 diff hist +42‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 8
• 15:5915:59, 13 March 2024 diff hist +1‎ Exercise: Multiple Alignments (English version) ‎ →‎Intermezzo - alternative splicing & protein isoforms
• 15:5815:58, 13 March 2024 diff hist −1‎ Exercise: Multiple Alignments (English version) ‎ →‎Intermezzo - alternative splicing & protein isoforms
• 15:5615:56, 13 March 2024 diff hist +2‎ Exercise: Multiple Alignments (English version) ‎ →‎Intermezzo - alternative splicing & protein isoforms
• 15:5615:56, 13 March 2024 diff hist +83‎ Exercise: Multiple Alignments (English version) ‎ →‎Intermezzo - alternative splicing & protein isoforms
• 15:5215:52, 13 March 2024 diff hist 0‎ N File:SpliceForms raz cropped.png ‎No edit summary current
• 15:5015:50, 13 March 2024 diff hist +42‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 4
• 15:4715:47, 13 March 2024 diff hist +6‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 1
• 15:4715:47, 13 March 2024 diff hist +36‎ Exercise: Multiple Alignments (English version) ‎ →‎Step 1
• 15:4215:42, 13 March 2024 diff hist 0‎ N File:JalView DNA1.png ‎No edit summary current
• 15:4115:41, 13 March 2024 diff hist 0‎ N File:Emblem-important tiny.png ‎No edit summary current
• 15:4015:40, 13 March 2024 diff hist 0‎ N File:Office-notes-line drawing.png ‎No edit summary current
• 15:3915:39, 13 March 2024 diff hist +20,953‎ N Exercise: Multiple Alignments (English version) ‎ Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with some editing by Henrik Nielsen and an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]. <!-- Click here for Danish version. --> ==Step 0 - installing Jalview == Go to https://www.jalview.org/, click the green downward..."
• 15:3715:37, 13 March 2024 diff hist 0‎ N File:SelecetionBlock.png ‎No edit summary current
• 15:3615:36, 13 March 2024 diff hist 0‎ N File:SelecetionNormal.png ‎No edit summary current
• 15:3615:36, 13 March 2024 diff hist 0‎ Plain text files and jEdit ‎ →‎Taking jEdit for a test run current
• 15:3515:35, 13 March 2024 diff hist 0‎ N File:Mac Finder icon.png ‎No edit summary current
• 15:3515:35, 13 March 2024 diff hist 0‎ N File:JEdit screenshot.png ‎No edit summary current
• 15:3415:34, 13 March 2024 diff hist +13,052‎ N Plain text files and jEdit ‎ Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC..."
• 15:3315:33, 13 March 2024 diff hist 0‎ N File:Geany rectangular selection cropped.png ‎No edit summary current
• 15:3215:32, 13 March 2024 diff hist 0‎ N File:Geany normal selection cropped.png ‎No edit summary current
• 15:3115:31, 13 March 2024 diff hist 0‎ Plain text files and Geany ‎ →‎Taking Geany for a test run
• 15:3015:30, 13 March 2024 diff hist 0‎ Plain text files and Geany ‎ →‎Taking Geany for a test run
• 15:2815:28, 13 March 2024 diff hist 0‎ N File:Geany sequence.gb cropped.png ‎No edit summary current