User contributions for WikiSysop
Jump to navigation
Jump to search
13 March 2024
- 16:2316:23, 13 March 2024 diff hist 0 N File:ApesTax 600.png No edit summary current
- 16:2216:22, 13 March 2024 diff hist +14,107 N Taxonomy databases Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with two added sections by Henrik Nielsen. ==Background== When comparing DNA and protein sequences from different species it is important to keep in mind that all living organisms at some point in time has shared a common ancestor. Some organisms are closely related and have recently derived from a common ancestor (e.g. Human and Chimpa..." current
- 16:2116:21, 13 March 2024 diff hist 0 22111:Course plan autumn 2023 →Tuesday Aug 29 — Introduction & taxonomy
- 16:1416:14, 13 March 2024 diff hist +42 Exercise: Phylogeny →Time to try on your own! current
- 16:1316:13, 13 March 2024 diff hist 0 N File:Phylo6.png No edit summary current
- 16:1216:12, 13 March 2024 diff hist 0 N File:Phylo5.png No edit summary current
- 16:1216:12, 13 March 2024 diff hist 0 N File:Phylo4.png No edit summary current
- 16:1116:11, 13 March 2024 diff hist 0 N File:Treehugger2.png No edit summary current
- 16:1116:11, 13 March 2024 diff hist 0 N File:Treehugger1.png No edit summary current
- 16:0916:09, 13 March 2024 diff hist +2 Exercise: Phylogeny →Step 2
- 16:0916:09, 13 March 2024 diff hist 0 N File:Mafft download.png No edit summary current
- 16:0816:08, 13 March 2024 diff hist +10 Exercise: Phylogeny →The Phylogeny of HIV
- 16:0716:07, 13 March 2024 diff hist +42 Exercise: Phylogeny →The Phylogeny of HIV
- 16:0616:06, 13 March 2024 diff hist +8,116 N Exercise: Phylogeny Created page with "Before you start: please install the [http://tree.bio.ed.ac.uk/software/figtree/ FigTree viewer] on your computer. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodeficiency Virus two (HIV-2). HIV-1 is responsible for the global pandemic, whil..."
- 16:0416:04, 13 March 2024 diff hist −16 Exercise: Multiple Alignments (English version) →Step 3 current
- 16:0416:04, 13 March 2024 diff hist +2 Exercise: Multiple Alignments (English version) →Step 8
- 16:0316:03, 13 March 2024 diff hist +42 Exercise: Multiple Alignments (English version) →Step 8
- 15:5915:59, 13 March 2024 diff hist +1 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 15:5815:58, 13 March 2024 diff hist −1 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 15:5615:56, 13 March 2024 diff hist +2 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 15:5615:56, 13 March 2024 diff hist +83 Exercise: Multiple Alignments (English version) →Intermezzo - alternative splicing & protein isoforms
- 15:5215:52, 13 March 2024 diff hist 0 N File:SpliceForms raz cropped.png No edit summary current
- 15:5015:50, 13 March 2024 diff hist +42 Exercise: Multiple Alignments (English version) →Step 4
- 15:4715:47, 13 March 2024 diff hist +6 Exercise: Multiple Alignments (English version) →Step 1
- 15:4715:47, 13 March 2024 diff hist +36 Exercise: Multiple Alignments (English version) →Step 1
- 15:4215:42, 13 March 2024 diff hist 0 N File:JalView DNA1.png No edit summary current
- 15:4115:41, 13 March 2024 diff hist 0 N File:Emblem-important tiny.png No edit summary current
- 15:4015:40, 13 March 2024 diff hist 0 N File:Office-notes-line drawing.png No edit summary current
- 15:3915:39, 13 March 2024 diff hist +20,953 N Exercise: Multiple Alignments (English version) Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with some editing by Henrik Nielsen and an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]. <!-- Click here for Danish version. --> ==Step 0 - installing Jalview == Go to https://www.jalview.org/, click the green downward..."
- 15:3715:37, 13 March 2024 diff hist 0 N File:SelecetionBlock.png No edit summary current
- 15:3615:36, 13 March 2024 diff hist 0 N File:SelecetionNormal.png No edit summary current
- 15:3615:36, 13 March 2024 diff hist 0 Plain text files and jEdit →Taking jEdit for a test run current
- 15:3515:35, 13 March 2024 diff hist 0 N File:Mac Finder icon.png No edit summary current
- 15:3515:35, 13 March 2024 diff hist 0 N File:JEdit screenshot.png No edit summary current
- 15:3415:34, 13 March 2024 diff hist +13,052 N Plain text files and jEdit Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC..."
- 15:3315:33, 13 March 2024 diff hist 0 N File:Geany rectangular selection cropped.png No edit summary current
- 15:3215:32, 13 March 2024 diff hist 0 N File:Geany normal selection cropped.png No edit summary current
- 15:3115:31, 13 March 2024 diff hist 0 Plain text files and Geany →Taking Geany for a test run
- 15:3015:30, 13 March 2024 diff hist 0 Plain text files and Geany →Taking Geany for a test run
- 15:2815:28, 13 March 2024 diff hist 0 N File:Geany sequence.gb cropped.png No edit summary current
- 15:2815:28, 13 March 2024 diff hist 0 N File:Ascii1.png No edit summary current
- 15:2715:27, 13 March 2024 diff hist 0 N File:WordFormat small.png No edit summary current
- 15:2515:25, 13 March 2024 diff hist +13,018 N Plain text files and Geany Created page with "Adapted from the exercise Plain text files and jEdit (originally written by [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson]) by [https://www.dtu.dk/person/henrik-nielsen?id=25617 Henrik Nielsen]. == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTC..."
- 15:2315:23, 13 March 2024 diff hist +20,925 N 22111:Course plan autumn 2023 Created page with "== General information == === Where and when === Lectures plus subsequent exercises will take place every Tuesday afternoon during the semester, starting '''Tuesday Aug 29 at 13:00'''. Lectures will be from 13:00 to approx. 14 in '''building 306, auditorium 33''', and the exercises will then take place in '''building 210, rooms 142+148+162+168'''. === Teachers === * [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik..."
- 15:2215:22, 13 March 2024 diff hist +2,043 N 22111 - Introduction to Bioinformatics Created page with "'''Formerly known as 36611 and 27611''' == Practical information == DTU's Studies Handbook about [http://www.kurser.dtu.dk/course/22111 #22111] This course is '''taught in English from 2019''' (previously taught in Danish), and it is a practically oriented, introductory 3rd semester (previously 4th semester) course. All students from DTU and other universities are welcome. For more information, please contact: Associate Professor [http://www.dtu.dk/service/telefonbog/..."
- 15:2215:22, 13 March 2024 diff hist +132 N MediaWiki:Sidebar Created page with " * navigation ** https://teaching.healthtech.dtu.dk/|Course List ** https://teaching.healthtech.dtu.dk/22111/|Course 22111 * TOOLBOX" current
- 15:2015:20, 13 March 2024 diff hist +38 N MediaWiki:Mainpage Created page with "22111 - Introduction to Bioinformatics" current
- 15:1715:17, 13 March 2024 diff hist 0 N MediaWiki:Disclaimers Created blank page current
- 15:1615:16, 13 March 2024 diff hist 0 N MediaWiki:Aboutsite Created blank page current
- 15:1615:16, 13 March 2024 diff hist 0 N MediaWiki:Privacy Created blank page current
