User contributions for Carol
Jump to navigation
Jump to search
21 October 2026
- 03:0803:08, 21 October 2026 diff hist −7 Exercise:AntibodyStructurePrediction →Part 1 — Identify the antibody regions
- 03:0603:06, 21 October 2026 diff hist +138 Exercise:AntibodyStructurePrediction →Part 1 — Identify the antibody regions
- 03:0303:03, 21 October 2026 diff hist +226 Exercise:AntibodyStructurePrediction →Part 1 — Identify the antibody regions
- 02:5602:56, 21 October 2026 diff hist +5 Exercise:AntibodyStructurePrediction No edit summary
- 02:5502:55, 21 October 2026 diff hist −16 Exercise:AntibodyStructurePrediction No edit summary
- 02:5302:53, 21 October 2026 diff hist +13 Exercise:AntibodyStructurePrediction No edit summary
- 02:5002:50, 21 October 2026 diff hist +9 Exercise:AntibodyStructurePrediction No edit summary
- 02:4902:49, 21 October 2026 diff hist −1 Exercise:AntibodyStructurePrediction No edit summary
- 02:4902:49, 21 October 2026 diff hist −1 Exercise:AntibodyStructurePrediction No edit summary
- 02:4602:46, 21 October 2026 diff hist +47 Exercise:AntibodyStructurePrediction →Antibody sequences
- 02:4402:44, 21 October 2026 diff hist +44 Exercise:AntibodyStructurePrediction No edit summary
- 02:4002:40, 21 October 2026 diff hist −524 Exercise:AntibodyStructurePrediction No edit summary
- 02:3702:37, 21 October 2026 diff hist −4,182 Exercise:AntibodyStructurePrediction v2 No edit summary current
- 02:2702:27, 21 October 2026 diff hist +1,288 Exercise:AntibodyStructurePrediction No edit summary
- 02:2602:26, 21 October 2026 diff hist +13 Exercise:AntibodyStructurePrediction →Modeling of CLL antibody
- 02:2402:24, 21 October 2026 diff hist −7,344 Exercise:AntibodyStructurePrediction No edit summary
- 02:2402:24, 21 October 2026 diff hist +11,777 N Exercise:AntibodyStructurePrediction v2 Created page with " = Antibody Structure Modelling: From Sequence to 3D Structure = '''Duration:''' 1–2 hours '''Requirements:''' [https://pymol.org/2/ PyMOL] and a web browser. == Introduction == Antibodies recognize antigens through six complementarity-determining regions (CDRs): three in the heavy chain and three in the light chain. These loops are supported by more conserved framework (FW) regions. Modern deep-learning tools can predict antibody structures directly from amino ac..."
20 October 2026
- 21:1021:10, 20 October 2026 diff hist +7,599 Exercise:AntibodyStructurePrediction No edit summary
- 20:5920:59, 20 October 2026 diff hist +4,178 N Exercise:AntibodyStructurePrediction Created page with "Antibody modelling Requirements: Pymol Download the version for your OS, then use the license file provided by the teachers Modeling of CLL antibody These are the sequences for the light and heavy chain of the antibody: >SI135 VH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTACCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAATTCCATATACTGCGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAACAAC..."
29 September 2026
- 21:5721:57, 29 September 2026 diff hist −1,428 Exercise:AllergenicityPrediction ans →PART C: Can you beat the baseline? current
- 21:5521:55, 29 September 2026 diff hist 0 Exercise:AllergenicityPrediction ans →PART B: Can you beat BLAST?
- 21:5321:53, 29 September 2026 diff hist −1 Exercise:AllergenicityPrediction ans →PART B: Can you beat BLAST?
- 21:5121:51, 29 September 2026 diff hist −105 Exercise:AllergenicityPrediction ans No edit summary
- 21:4821:48, 29 September 2026 diff hist +10,286 Exercise:AllergenicityPrediction ans No edit summary
- 21:3921:39, 29 September 2026 diff hist −2 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST? current
- 21:3521:35, 29 September 2026 diff hist +180 Exercise:AllergenicityPrediction →PART A: Investigating Allergenicity
- 21:2721:27, 29 September 2026 diff hist −897 Exercise:AllergenicityPrediction No edit summary
- 21:1221:12, 29 September 2026 diff hist +2 Exercise:AllergenicityPrediction →PART C Can you beat the baseline?
- 21:1121:11, 29 September 2026 diff hist +1 Exercise:AllergenicityPrediction ans →PART B: Can you beat BLAST
- 21:1121:11, 29 September 2026 diff hist +36 Exercise:AllergenicityPrediction ans →Answers
- 21:1121:11, 29 September 2026 diff hist +1 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 21:1121:11, 29 September 2026 diff hist +3 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 21:1021:10, 29 September 2026 diff hist +2 Exercise:AllergenicityPrediction →PART A: Investigating Allergenicity
- 21:1021:10, 29 September 2026 diff hist −101 Exercise:AllergenicityPrediction →PART A: Investigating Allergenicity
- 21:1021:10, 29 September 2026 diff hist +9 Exercise:AllergenicityPrediction ans →Get the Data and Filter It
- 21:0921:09, 29 September 2026 diff hist +891 N Exercise:AllergenicityPrediction ans Created page with "== Answers == === Get the Data and Filter It === *'''Q1A:''' What would be your first approach to determine whether brown algae contain potential allergens? Find one database containing experimentally characterized allergens. Consider what biological information you would search for and what properties of the proteins might provide evidence of allergenic potential. '''Answer:''' *'''Q1B:''' Now imagine that no computational predictor specifically designed for allerg..."
- 21:0521:05, 29 September 2026 diff hist 0 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:5720:57, 29 September 2026 diff hist −34 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:5520:55, 29 September 2026 diff hist +1 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:5520:55, 29 September 2026 diff hist −572 Exercise:AllergenicityPrediction →Learning Objectives
- 20:5320:53, 29 September 2026 diff hist +1 Exercise:AllergenicityPrediction →PART C Can you beat the baseline?
- 20:5320:53, 29 September 2026 diff hist −128 Exercise:AllergenicityPrediction →PART C Can you beat the baseline?
- 20:5220:52, 29 September 2026 diff hist 0 Exercise:AllergenicityPrediction →PART C Can you beat the baseline?
- 20:5020:50, 29 September 2026 diff hist −746 Exercise:AllergenicityPrediction No edit summary
- 20:4920:49, 29 September 2026 diff hist −725 Exercise:AllergenicityPrediction →PART C Can you build a better predictor
- 20:4420:44, 29 September 2026 diff hist −125 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:3920:39, 29 September 2026 diff hist −189 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:3820:38, 29 September 2026 diff hist 0 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:3620:36, 29 September 2026 diff hist −1 Exercise:AllergenicityPrediction →PART B: Can you beat BLAST
- 20:3520:35, 29 September 2026 diff hist +952 Exercise:AllergenicityPrediction →PART B: Develop your own allergenicity predictor