Exercise:AntibodyStructurePrediction: Revision history

21 October 2026

• curprev 04:1704:17, 21 October 2026‎ Carol talk contribs‎ 6,469 bytes +2‎ →‎Identifying mutations in the antibody sequence
• curprev 04:1604:16, 21 October 2026‎ Carol talk contribs‎ 6,467 bytes +204‎ →‎Identifying mutations in the antibody sequence
• curprev 03:2503:25, 21 October 2026‎ Carol talk contribs‎ 6,263 bytes +6‎ →‎Visualizing the antigen-binding site
• curprev 03:2403:24, 21 October 2026‎ Carol talk contribs‎ 6,257 bytes +545‎ →‎Part 1 — Identify the antibody regions
• curprev 03:1403:14, 21 October 2026‎ Carol talk contribs‎ 5,712 bytes −1‎ →‎Part 1 — Identify the antibody regions
• curprev 03:1403:14, 21 October 2026‎ Carol talk contribs‎ 5,713 bytes +46‎ No edit summary
• curprev 03:0803:08, 21 October 2026‎ Carol talk contribs‎ 5,667 bytes 0‎ →‎Part 1 — Identify the antibody regions
• curprev 03:0803:08, 21 October 2026‎ Carol talk contribs‎ 5,667 bytes −7‎ →‎Part 1 — Identify the antibody regions
• curprev 03:0603:06, 21 October 2026‎ Carol talk contribs‎ 5,674 bytes +138‎ →‎Part 1 — Identify the antibody regions
• curprev 03:0303:03, 21 October 2026‎ Carol talk contribs‎ 5,536 bytes +226‎ →‎Part 1 — Identify the antibody regions
• curprev 02:5602:56, 21 October 2026‎ Carol talk contribs‎ 5,310 bytes +5‎ No edit summary
• curprev 02:5502:55, 21 October 2026‎ Carol talk contribs‎ 5,305 bytes −16‎ No edit summary
• curprev 02:5302:53, 21 October 2026‎ Carol talk contribs‎ 5,321 bytes +13‎ No edit summary
• curprev 02:5002:50, 21 October 2026‎ Carol talk contribs‎ 5,308 bytes +9‎ No edit summary
• curprev 02:4902:49, 21 October 2026‎ Carol talk contribs‎ 5,299 bytes −1‎ No edit summary
• curprev 02:4902:49, 21 October 2026‎ Carol talk contribs‎ 5,300 bytes −1‎ No edit summary
• curprev 02:4602:46, 21 October 2026‎ Carol talk contribs‎ 5,301 bytes +47‎ →‎Antibody sequences
• curprev 02:4402:44, 21 October 2026‎ Carol talk contribs‎ 5,254 bytes +44‎ No edit summary
• curprev 02:4002:40, 21 October 2026‎ Carol talk contribs‎ 5,210 bytes −524‎ No edit summary
• curprev 02:2702:27, 21 October 2026‎ Carol talk contribs‎ 5,734 bytes +1,288‎ No edit summary
• curprev 02:2602:26, 21 October 2026‎ Carol talk contribs‎ 4,446 bytes +13‎ →‎Modeling of CLL antibody
• curprev 02:2402:24, 21 October 2026‎ Carol talk contribs‎ 4,433 bytes −7,344‎ No edit summary

20 October 2026

• curprev 21:1021:10, 20 October 2026‎ Carol talk contribs‎ 11,777 bytes +7,599‎ No edit summary
• curprev 20:5920:59, 20 October 2026‎ Carol talk contribs‎ 4,178 bytes +4,178‎ Created page with "Antibody modelling Requirements: Pymol Download the version for your OS, then use the license file provided by the teachers Modeling of CLL antibody These are the sequences for the light and heavy chain of the antibody: >SI135 VH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTACCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAATTCCATATACTGCGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAACAAC..."