User contributions for WikiSysop
Jump to navigation
Jump to search
5 March 2024
- 16:2816:28, 5 March 2024 diff hist −1 m Autumn2023 →Lecture 04 (Sep 21) - Yeast Systems Biology 1
- 16:2716:27, 5 March 2024 diff hist +8,280 N ExYeastSysBio R answers Created page with "= Answers to the first yeast systems biology exercise = '''Answers by:''' Lars Rønn Olsen and Rasmus Wernersson == Report questions #1 == <pre style="overflow:auto;"> library(igraph) library(ggraph) load("/home/projects/22140/exercise4.Rdata") g <- graph_from_data_frame(interactions, directed = FALSE, vertices = node_attributes) ggraph(g) + geom_edge_link(aes(color = score)) + scale_edge_color_continuous(limits = c(0,1), low = "red", high = "black") + geom_n..." current
- 16:1716:17, 5 March 2024 diff hist 0 N File:Yeast network navigation guide CS 3.5.1.png No edit summary current
- 16:1616:16, 5 March 2024 diff hist 0 N File:YeastProteinInteractionNetwork.jpg No edit summary current
- 16:1516:15, 5 March 2024 diff hist 0 N File:Chromarms.gif No edit summary current
- 16:1416:14, 5 March 2024 diff hist +13,954 N ExYeastSysBio R Created page with "= Exercise: Yeast Cell Cycle 1 - introduction = Exercise written by: Rasmus Wernersson and Lars Rønn Olsen = Data and databases = == Yeast genes and the Saccharomyces Genome Database == We have previously been working with UniProt based data for the exercises in week 1. UniProt is generally speaking one of the most reliable and well annotated databases out there. However, for Yeast there exists an even more dedicated database that has a 100% focus on Yeast: * The ''..." current
- 16:1216:12, 5 March 2024 diff hist +5,208 N ExTopology1 igraph solutions Created page with "= Exercise: Network topology and statistics = '''Exercise written by: Lars Rønn Olsen''' Notes on today's exercise: today we will get a bit more advanced in our use of igraph. If you get stuck, remember that ''Google and chatGPT are your friends.'' == Part I. Getting started == <pre style="overflow:auto;"> load("/home/projects/22140/exercise3.Rdata") </pre> '''TASK: Create an igraph object with node attributes''' <pre style="overflow:auto;"> g <- graph_from_data_f..." current
- 16:1216:12, 5 March 2024 diff hist +6,378 N ExTopology1 igraph Created page with "= Exercise: Network topology and statistics = '''Exercise written by: Lars Rønn Olsen''' Notes on today's exercise: today we will get a bit more advanced in our use of igraph. If you get stuck, remember that ''Google and chatGPT are your friends.'' == Part I. Getting started == In this exercise we will use a subset of the human interaction dataset by Rual et al. (Nature.2005 Oct 20;437(7062):1173-8). The data consists of an interaction data frame (without edge annot..."
- 16:1116:11, 5 March 2024 diff hist −27 m Autumn2023 →Lecture 03 (Sep 14) - Intro 3
- 16:0616:06, 5 March 2024 diff hist +2,479 N Ex handouts igraph solution Created page with "= Part 1 - network from AP/MS data = Interaction data from exercise 5 and edge scores from exercise 6 <pre style="overflow:auto;"> library(igraph) library(ggraph) ex5_interactions <- data.frame(from = c("A", "B", "B", "B", "B", "B", "D", "D", "E", "F", "F"), to = c("B", "C", "D", "E", "F", "H", "F", "G", "H", "G", "H"), score = c(-0.155, -0.234, -0.222, -0.183, -0.183, -0.183, -0.301, -0.194, -0.301, -0.301, -0.301)) g <- graph_from_data_frame(ex5_interactions, d..." current
- 16:0616:06, 5 March 2024 diff hist +772 N Ex handouts igraph Created page with "= PPI Data visualization: extension to the hand-out exercise = Exercise written by Lars Rønn Olsen and Rasmus Wernersson This is a short igraph visualization exercise based on the networks and scores derived in the hand-out exercises. == Part 1 - network from AP/MS data == 30px|left'''Part 1''' * Create a data frame based on the network derived from '''exercise 5''' * Create an edge annotation vector based on the scores calcul..." current
- 16:0516:05, 5 March 2024 diff hist 0 N File:Exercise help sheet.pdf No edit summary current
- 16:0416:04, 5 March 2024 diff hist +4 m Autumn2023 →Block #1: Introduction
- 16:0316:03, 5 March 2024 diff hist 0 N File:W02 exercises v7 corrected.pdf No edit summary current
- 16:0116:01, 5 March 2024 diff hist 0 N File:Extended pold w attributes.png No edit summary current
- 16:0016:00, 5 March 2024 diff hist 0 N File:POLD excel after.png No edit summary current
- 15:5915:59, 5 March 2024 diff hist 0 N File:Pold w node attributes.png No edit summary current
- 15:5815:58, 5 March 2024 diff hist +5,947 N IgraphIntro Answers v1 Created page with "= Aswers: " Cytoscape and network intro exercise" = '''Answers by:''' Lars Rønn Olsen and Rasmus Wernersson = Item #1: Loading network as an igraph object = <pre style="overflow:auto;"> library(igraph) df <- data.frame(from = c("alpha", "alpha", "beta"), to = c("alpha", "beta", "beta")) g <- graph_from_data_frame(df, directed = FALSE) </pre> = Item #2: Node attributes and visualization = <pre style="overflow:auto;"> poldelta_graph <- data.frame(from = c("DPOD1_HUMAN"..." current
- 15:5715:57, 5 March 2024 diff hist 0 N File:PolDelta network node info sheet 2020.PNG No edit summary current
- 15:5615:56, 5 March 2024 diff hist 0 N File:Poldelta extended stress layout.png No edit summary current
- 15:5515:55, 5 March 2024 diff hist 0 N File:Igraph pol delta.png No edit summary current
- 15:5415:54, 5 March 2024 diff hist 0 N File:1000px-DNA replication en.svg.png No edit summary current
- 15:5415:54, 5 March 2024 diff hist 0 N File:Igraph hemoglobin.png No edit summary current
- 14:3714:37, 5 March 2024 diff hist 0 N File:Hemoglobin structure 200px.png No edit summary current
- 14:2914:29, 5 March 2024 diff hist −8 m ExJEdit →Taking jEdit for a test run current
- 13:4813:48, 5 March 2024 diff hist 0 N File:SelecetionBlock.png No edit summary current
- 13:4813:48, 5 March 2024 diff hist 0 N File:SelecetionNormal.png No edit summary current
- 13:4713:47, 5 March 2024 diff hist 0 N File:Mac Finder icon.png No edit summary current
- 13:4413:44, 5 March 2024 diff hist 0 N File:NotePad WinFile.png No edit summary current
- 13:4413:44, 5 March 2024 diff hist 0 N File:NotePad UnixFile.png No edit summary current
- 13:4213:42, 5 March 2024 diff hist 0 N File:Ascii1.png No edit summary current
- 13:4113:41, 5 March 2024 diff hist 0 N File:WordFormat small.png No edit summary current
- 13:4013:40, 5 March 2024 diff hist +12,804 N ExJEdit Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC..."
- 13:3913:39, 5 March 2024 diff hist 0 N File:JEdit screenshot.png No edit summary current
- 13:1513:15, 5 March 2024 diff hist +17,457 N IgraphIntro Ex v1 Created page with "= Introduction to working with networks in R = '''Exercise written by:''' Rasmus Wernersson and Lars Rønn Olsen The purpose is to give a general introduction to the R packages [https://r.igraph.org/ '''igraph'''] and [http://users.dimi.uniud.it/~massimo.franceschet/ns/syllabus/make/ggraph/ggraph.html '''ggraph'''], which we will be using for a large part of the course for: # Building and storing networks in R # Visualization / inspection of biological networks # Data..."
- 13:1313:13, 5 March 2024 diff hist +3,874 N ExUniProt-answers Created page with "== Answers to "Exercise: Protein databases" == The numbers are found using UniProt on Feb 10, 2017 (release 2017_01). ===Simple text mining=== '''QUESTION 1:''' # How many hits do you find? <br>3150 # How many of these hits are from Swiss-Prot? <br>1254 # Can you identify the correct hit (''i.e.'' see which one is actually human insulin and not something else)? <br>It's P01308 / INS_HUMAN (among the first ten hits). '''QUESTION 2:''' How many hits are now left? How m..." current
- 13:1213:12, 5 March 2024 diff hist 0 N File:Uniprotlogo.gif No edit summary current
- 13:1013:10, 5 March 2024 diff hist 0 N File:UniProt-search-button.png No edit summary current
- 13:0913:09, 5 March 2024 diff hist 0 N File:Office-notes-line drawing.png No edit summary current
- 13:0813:08, 5 March 2024 diff hist 0 N File:Emblem-important tiny.png No edit summary current
- 13:0613:06, 5 March 2024 diff hist +17,340 N Exercise: The protein database UniProt Created page with "Exercise written by: Henrik Nielsen - updated by Morten Nielsen and Rasmus Wernersson right|frame|UniProt logo as of 2010 - source: http://www.uniprot.org __TOC__ In this exercise, we shall extract information from the protein database, Uniprot. This database is administrated in collaboration between [http://www.isb-sib.ch/ Swiss Institute of Bioinformatics (SIB)], [http://www.ebi.ac.uk/ European Bioinformatics Institute (EBI)], England, and [ht..." current
- 13:0513:05, 5 March 2024 diff hist +13,958 N Autumn2023 Created page with "= Course 22140 - plan for autumn 2023 = <!-- = General information = --> '''Teachers:''' * Lars Rønn Olsen (course organizer) - '''contact:''' [mailto:lronn@dtu.dk lronn@dtu.dk] * Kristoffer Vitting-Seerup (course organizer) - '''contact:''' [mailto:krivi@dtu.dk krivi@dtu.dk] * Rasmus Wernersson (external lecturer) - '''contact:''' [mailto:rawe@dtu.dk rawe@dtu.dk] * Hanxi Li (teaching assistant) - '''contact:''' [mailto:hanxli@dtu.dk hanxli@dtu.dk] <!-- '''Main cour..."
- 13:0213:02, 5 March 2024 diff hist 0 m MediaWiki:Sidebar No edit summary current
- 13:0113:01, 5 March 2024 diff hist +131 N MediaWiki:Sidebar Created page with " * navigation ** https://teaching.healthtech.dtu.dk/|Course List ** https://teaching.healthtech.dtu.dk/22101/|22140/22141 * TOOLBOX"
- 12:5712:57, 5 March 2024 diff hist 0 N File:Network example1.png No edit summary current
- 12:5512:55, 5 March 2024 diff hist +2,221 N 22140/22141 - Introduction to Systems Biology Created page with "'' Previously known as 36040 and 27040: Introduction to Systems Biology (bachelor course) '' <!-- This is the main page for the ''"Introduction to Systems Biology"'' course (previously known as '''27040''' but not to be confused with the Master's level course '''27641''') --> 600px|center|Network example: Protein-Protein interaction network for biomarkers involved in depression - Larsen & Wernersson, 2012. == About the course == The ''"Int..."
- 12:5312:53, 5 March 2024 diff hist +45 N MediaWiki:Mainpage Created page with "22140/22141 - Introduction to Systems Biology" current
- 12:5212:52, 5 March 2024 diff hist 0 N MediaWiki:Disclaimers Created blank page current
- 12:5112:51, 5 March 2024 diff hist 0 N MediaWiki:Aboutsite Created blank page current
- 12:5112:51, 5 March 2024 diff hist 0 N MediaWiki:Privacy Created blank page current