All public logs

Combined display of all available logs of 22111. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

11:51, 15 March 2024 WikiSysop talk contribs created page File:Gaps-2014-1g.JPG
11:51, 15 March 2024 WikiSysop talk contribs uploaded File:Gaps-2014-1g.JPG
11:50, 15 March 2024 WikiSysop talk contribs created page FAQ (Created page with "== Practical information == === Exam === * ''How do I find out where and when the exam is held?'' At http://www.eksamensplan.dtu.dk/ . * ''Which online platform will you use for the exam?'' This year we will be using Digital Exam (the new interface) which is accessed via https://eksamen.dtu.dk/ . We will ''not'' be using the old interface via http://onlineeksamen.dtu.dk/ . <!-- === COVID-19 information 2021 === This year, the written exam will be a '''home exam'''....")
11:48, 15 March 2024 WikiSysop talk contribs created page Link collection (Created page with "== Taxonomy == ;Tree of Life http://www.tolweb.org/ :(Good descriptive Taxonomy database — limited range of organisms). ;NCBI Taxonomy http://www.ncbi.nlm.nih.gov/Taxonomy/ :(Somewhat "technical" but very exhaustive taxonomical database. TaxIDs are also used in GenBank and UniProt). : The "Common Tree" function can be used to investigate how closely related two or more organisms are: http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi : NCBI search with "Toke...")
11:42, 15 March 2024 WikiSysop talk contribs created page Checklist for computers (Created page with "At the exam in Introduction to Bioinformatics, you are going to use the same resources (web-servers and programs) that you used for the exercises — if your computer has worked fine for all the exercises, it will also work fine for the exam. == Hardware == ; A laptop. : It makes no difference whether you use Windows, Mac, or Linux, as long as you have the listed software. However, an iPad, an Android tablet, or a Chromebook will NOT be enough for the exam. ; A mouse. :...")
11:33, 15 March 2024 WikiSysop talk contribs created page ExMulAlign-Answers (Created page with "Click here for English version. =Svar til Multiple Alignment øvelsen= Af: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Spørgsmål 1== Fasta fil: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTT...")
11:30, 15 March 2024 WikiSysop talk contribs created page File:Ribosomal proteins 34.newick.txt.png
11:30, 15 March 2024 WikiSysop talk contribs uploaded File:Ribosomal proteins 34.newick.txt.png
11:29, 15 March 2024 WikiSysop talk contribs created page File:NCBI-common-tree.png
11:29, 15 March 2024 WikiSysop talk contribs uploaded File:NCBI-common-tree.png
11:28, 15 March 2024 WikiSysop talk contribs created page File:Salmon frog.png
11:28, 15 March 2024 WikiSysop talk contribs uploaded File:Salmon frog.png
11:28, 15 March 2024 WikiSysop talk contribs created page File:Mafft tree.png
11:28, 15 March 2024 WikiSysop talk contribs uploaded File:Mafft tree.png
11:25, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny-Answers (Created page with "== Answers to the Phylogeny exercise == === Step 8 === Answers to "The Phylogeny of HIV" can be found [https://teaching.healthtech.dtu.dk/material/36611/files/binfintro/hiv_origin.html here].  === Step 9 === * How did you construct the tree? (alignment method, construction of tree, outgroup etc. ) For starters you need to do a multiple alignment of your sequences. A number o...")
11:22, 15 March 2024 WikiSysop talk contribs created page Exercise: Phylogeny (Seaview version) (Created page with "Before you start: please make sure you have the Seaview program installed on your computer. If not, see the Multiple alignment exercise. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodefici...")
11:14, 15 March 2024 WikiSysop talk contribs created page File:Q7-MAFFT.png
11:14, 15 March 2024 WikiSysop talk contribs uploaded File:Q7-MAFFT.png
11:13, 15 March 2024 WikiSysop talk contribs created page File:Jalview Q2c.png
11:13, 15 March 2024 WikiSysop talk contribs uploaded File:Jalview Q2c.png
11:12, 15 March 2024 WikiSysop talk contribs created page ExMulAlign-Answers-English (Created page with "Click here for Danish version. =Answers to the Multiple Alignment exercise= By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGC...")
11:06, 15 March 2024 WikiSysop talk contribs created page File:Seaview-Q1-unaligned.png
11:06, 15 March 2024 WikiSysop talk contribs uploaded File:Seaview-Q1-unaligned.png
11:04, 15 March 2024 WikiSysop talk contribs created page Exercise: Multiple Alignments (Seaview version) (Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]; transcribed to use Seaview by [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik Nielsen]. ==Step 0 — installing Seaview == In this exercise, we a...")
11:03, 15 March 2024 WikiSysop talk contribs created page ExPSIBLAST answer (Created page with "Note: E-values etc. are found November 8, 2023. == When BLAST fails == * '''QUESTION 1''': How many significant hits does BLAST find (E-value < 0.005)? Answer: No sequences with E-value below 0.005. ==Trying another approach== * '''QUESTION 2''': How many significant hits does BLAST find (E-value < 0.005)? Answer: After the first iteration, 363 hits are found. * '''QUESTION 3''': How large a fraction of the query sequence do the significant hits match (excluding the...")
11:00, 15 March 2024 WikiSysop talk contribs created page File:Psiblastp nr.png
11:00, 15 March 2024 WikiSysop talk contribs uploaded File:Psiblastp nr.png
10:59, 15 March 2024 WikiSysop talk contribs created page File:Blastp pdb.png
10:59, 15 March 2024 WikiSysop talk contribs uploaded File:Blastp pdb.png
10:59, 15 March 2024 WikiSysop talk contribs created page ExPSIBLAST (Created page with "Originally written by: Morten Nielsen — some editing by Rasmus Wernersson and Bent Petersen — new version by Henrik Nielsen. ==Introduction== Earlier in the course you have used the BLAST program to perform fast alignments of DNA and protein sequences. As shown in today's lecture, BLAST will often fail to recognize relationships between proteins with low sequence similarity. In today's exercise, you will use the iterative BLAST program (PSI-BLAST) to calculate sequ...")
10:58, 15 March 2024 WikiSysop talk contribs created page ExLogo+Matrix-answers (Created page with "Answers to "Construction of sequence logos and weight matrices" == Identification of MHC binding motifs == '''QUESTION 1:''' Which positions are anchor position and what amino acids are found at the anchor positions? :Anchor positions are P2 and P9. Preferred amino acids are P2: LM, P9: VL. You don't have to take the "Auxiliary anchor" into account. == Construction of weightmatrices == '''Unnumbered question:''' Have a look at the sequence logo. How many differen...")
10:54, 15 March 2024 WikiSysop talk contribs created page File:Weight.png
10:54, 15 March 2024 WikiSysop talk contribs uploaded File:Weight.png
10:51, 15 March 2024 WikiSysop talk contribs created page File:HLA-A0201.gif
10:51, 15 March 2024 WikiSysop talk contribs uploaded File:HLA-A0201.gif
10:51, 15 March 2024 WikiSysop talk contribs created page Exercise: Construction of sequence logos and weight matrices (Created page with "Exercise by: [https://www.dtu.dk/service/telefonbog/Person?id=5973 Morten Nielsen] - editing by Rasmus Wernerson ==Overview== You shall use Bioinformatics tools to predict peptide-MHC binding and select potential epitope vaccine candidates. The exercise has four parts: #Identification of MHC binding motif #Visualize the motif using sequence logos #Training of MHC binding prediction methods #Use the MHC binding prediction method to select potential epitope vaccine cand...")
10:42, 15 March 2024 WikiSysop talk contribs created page File:Q11 pseudo 200.png
10:42, 15 March 2024 WikiSysop talk contribs uploaded File:Q11 pseudo 200.png
10:42, 15 March 2024 WikiSysop talk contribs created page File:Q11 pseudo 00.png
10:42, 15 March 2024 WikiSysop talk contribs uploaded File:Q11 pseudo 00.png
10:41, 15 March 2024 WikiSysop talk contribs created page File:Q9 EUK.png
10:41, 15 March 2024 WikiSysop talk contribs uploaded File:Q9 EUK.png
10:41, 15 March 2024 WikiSysop talk contribs created page File:Q8 gram pos.png
10:41, 15 March 2024 WikiSysop talk contribs uploaded File:Q8 gram pos.png
10:41, 15 March 2024 WikiSysop talk contribs created page File:Q8 gram neg.png
10:41, 15 March 2024 WikiSysop talk contribs uploaded File:Q8 gram neg.png
10:40, 15 March 2024 WikiSysop talk contribs created page File:Q8 EUK.png
10:40, 15 March 2024 WikiSysop talk contribs uploaded File:Q8 EUK.png
10:40, 15 March 2024 WikiSysop talk contribs created page File:Q7 yeast 40-50 zoom freq.png
10:40, 15 March 2024 WikiSysop talk contribs uploaded File:Q7 yeast 40-50 zoom freq.png

All public logs

Navigation menu

Search