User contributions for WikiSysop

15 March 2024

• 11:4411:44, 15 March 2024 diff hist +42‎ Checklist for computers ‎ →‎Software
• 11:4211:42, 15 March 2024 diff hist +3,522‎ N Checklist for computers ‎ Created page with "At the exam in Introduction to Bioinformatics, you are going to use the same resources (web-servers and programs) that you used for the exercises — if your computer has worked fine for all the exercises, it will also work fine for the exam. == Hardware == ; A laptop. : It makes no difference whether you use Windows, Mac, or Linux, as long as you have the listed software. However, an iPad, an Android tablet, or a Chromebook will NOT be enough for the exam. ; A mouse. :..."
• 11:4111:41, 15 March 2024 diff hist +54‎ 22111:Course plan autumn 2023 ‎ →‎Thursday Dec 14 current
• 11:3311:33, 15 March 2024 diff hist +19,722‎ N ExMulAlign-Answers ‎ Created page with "Click here for English version. =Svar til Multiple Alignment øvelsen= Af: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Spørgsmål 1== Fasta fil: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTT..." current
• 11:3111:31, 15 March 2024 diff hist +32‎ m Exercise: Phylogeny-Answers ‎ →‎Step 10 current
• 11:3111:31, 15 March 2024 diff hist +42‎ m Exercise: Phylogeny-Answers ‎ →‎Step 10
• 11:3011:30, 15 March 2024 diff hist 0‎ N File:Ribosomal proteins 34.newick.txt.png ‎No edit summary current
• 11:2911:29, 15 March 2024 diff hist 0‎ N File:NCBI-common-tree.png ‎No edit summary current
• 11:2811:28, 15 March 2024 diff hist 0‎ N File:Salmon frog.png ‎No edit summary current
• 11:2811:28, 15 March 2024 diff hist 0‎ N File:Mafft tree.png ‎No edit summary current
• 11:2711:27, 15 March 2024 diff hist +13‎ Exercise: Phylogeny-Answers ‎ →‎Step 9
• 11:2611:26, 15 March 2024 diff hist −71‎ Exercise: Phylogeny-Answers ‎ →‎Step 8
• 11:2511:25, 15 March 2024 diff hist +13,041‎ N Exercise: Phylogeny-Answers ‎ Created page with "== Answers to the Phylogeny exercise == === Step 8 === Answers to "The Phylogeny of HIV" can be found [https://teaching.healthtech.dtu.dk/material/36611/files/binfintro/hiv_origin.html here]. <!-- http://www.cbs.dtu.dk/courses/biosys/binfintro/hiv_origin.php --> === Step 9 === * How did you construct the tree? (alignment method, construction of tree, outgroup etc. ) For starters you need to do a multiple alignment of your sequences. A number o..."
• 11:2411:24, 15 March 2024 diff hist +42‎ Exercise: Phylogeny (Seaview version) ‎ →‎Comparing trees current
• 11:2211:22, 15 March 2024 diff hist +52‎ m Exercise: Phylogeny (Seaview version) ‎ →‎The Phylogeny of HIV
• 11:2211:22, 15 March 2024 diff hist +12,799‎ N Exercise: Phylogeny (Seaview version) ‎ Created page with "Before you start: please make sure you have the Seaview program installed on your computer. If not, see the Multiple alignment exercise. == The Phylogeny of HIV == In this exercise you will analyze the evolutionary relationship between HIV-related viruses from man and monkeys: Acquired Immune Deficiency Syndrome (AIDS) is caused by two divergent viruses, Human Immunodeficiency Virus one (HIV-1) and Human Immunodefici..."
• 11:2011:20, 15 March 2024 diff hist +42‎ 22111:Course plan autumn 2023 ‎ →‎Tuesday Nov 21 — Phylogenetic trees
• 11:1511:15, 15 March 2024 diff hist +125‎ ExMulAlign-Answers-English ‎ →‎Question 1 current
• 11:1411:14, 15 March 2024 diff hist 0‎ N File:Q7-MAFFT.png ‎No edit summary current
• 11:1311:13, 15 March 2024 diff hist 0‎ N File:Jalview Q2c.png ‎No edit summary current
• 11:1211:12, 15 March 2024 diff hist +21,715‎ N ExMulAlign-Answers-English ‎ Created page with "Click here for Danish version. =Answers to the Multiple Alignment exercise= By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGC..."
• 11:1011:10, 15 March 2024 diff hist +2‎ Exercise: Multiple Alignments (Seaview version) ‎ →‎Step 8
• 11:1011:10, 15 March 2024 diff hist +42‎ Exercise: Multiple Alignments (Seaview version) ‎ →‎Step 8
• 11:0911:09, 15 March 2024 diff hist +43‎ m Exercise: Multiple Alignments (Seaview version) ‎ →‎Step 4
• 11:0711:07, 15 March 2024 diff hist +2‎ Exercise: Multiple Alignments (Seaview version) ‎ →‎Step 3
• 11:0611:06, 15 March 2024 diff hist +42‎ m Exercise: Multiple Alignments (Seaview version) ‎ →‎Part 1 — using Clustal Omega in Seaview
• 11:0611:06, 15 March 2024 diff hist 0‎ N File:Seaview-Q1-unaligned.png ‎No edit summary current
• 11:0411:04, 15 March 2024 diff hist +18,322‎ N Exercise: Multiple Alignments (Seaview version) ‎ Created page with "Exercise written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] with an intermezzo by [http://www.dtu.dk/service/telefonbog/person?id=5118&cpid=214070&tab=2&qt=dtupublicationquery Anders Gorm Pedersen]; transcribed to use Seaview by [http://www.dtu.dk/service/telefonbog/person?id=25617&cpid=257116&tab=2&qt=dtupublicationquery Henrik Nielsen]. ==Step 0 — installing Seaview == In this exercise, we a..."
• 11:0311:03, 15 March 2024 diff hist +9,967‎ N ExPSIBLAST answer ‎ Created page with "Note: E-values etc. are found November 8, 2023. == When BLAST fails == * '''QUESTION 1''': How many significant hits does BLAST find (E-value < 0.005)? Answer: No sequences with E-value below 0.005. ==Trying another approach== * '''QUESTION 2''': How many significant hits does BLAST find (E-value < 0.005)? Answer: After the first iteration, 363 hits are found. * '''QUESTION 3''': How large a fraction of the query sequence do the significant hits match (excluding the..."
• 11:0111:01, 15 March 2024 diff hist 0‎ ExPSIBLAST ‎ →‎When BLAST fails current
• 11:0111:01, 15 March 2024 diff hist 0‎ ExPSIBLAST ‎ →‎Trying another approach
• 11:0011:00, 15 March 2024 diff hist 0‎ N File:Psiblastp nr.png ‎No edit summary current
• 10:5910:59, 15 March 2024 diff hist 0‎ N File:Blastp pdb.png ‎No edit summary current
• 10:5910:59, 15 March 2024 diff hist +13,783‎ N ExPSIBLAST ‎ Created page with "Originally written by: Morten Nielsen — some editing by Rasmus Wernersson and Bent Petersen — new version by Henrik Nielsen. ==Introduction== Earlier in the course you have used the BLAST program to perform fast alignments of DNA and protein sequences. As shown in today's lecture, BLAST will often fail to recognize relationships between proteins with low sequence similarity. In today's exercise, you will use the iterative BLAST program (PSI-BLAST) to calculate sequ..."
• 10:5810:58, 15 March 2024 diff hist +5,512‎ N ExLogo+Matrix-answers ‎ Created page with "Answers to "Construction of sequence logos and weight matrices" == Identification of MHC binding motifs == '''QUESTION 1:''' Which positions are anchor position and what amino acids are found at the anchor positions? :Anchor positions are P2 and P9. Preferred amino acids are P2: LM, P9: VL. You don't have to take the "Auxiliary anchor" into account. == Construction of weightmatrices == '''Unnumbered question:''' Have a look at the sequence logo. How many differen..." current
• 10:5610:56, 15 March 2024 diff hist 0‎ m Exercise: Construction of sequence logos and weight matrices ‎ →‎Finding epitopes in real proteins
• 10:5610:56, 15 March 2024 diff hist 0‎ m Exercise: Construction of sequence logos and weight matrices ‎ →‎Data
• 10:5410:54, 15 March 2024 diff hist 0‎ N File:Weight.png ‎No edit summary current
• 10:5410:54, 15 March 2024 diff hist +4‎ m Exercise: Construction of sequence logos and weight matrices ‎ →‎Construction of weightmatrices
• 10:5310:53, 15 March 2024 diff hist 0‎ m Exercise: Construction of sequence logos and weight matrices ‎ →‎Prediction performance
• 10:5110:51, 15 March 2024 diff hist 0‎ N File:HLA-A0201.gif ‎No edit summary current
• 10:5110:51, 15 March 2024 diff hist +16,126‎ N Exercise: Construction of sequence logos and weight matrices ‎ Created page with "Exercise by: [https://www.dtu.dk/service/telefonbog/Person?id=5973 Morten Nielsen] - editing by Rasmus Wernerson ==Overview== You shall use Bioinformatics tools to predict peptide-MHC binding and select potential epitope vaccine candidates. The exercise has four parts: #Identification of MHC binding motif #Visualize the motif using sequence logos #Training of MHC binding prediction methods #Use the MHC binding prediction method to select potential epitope vaccine cand..."
• 10:5010:50, 15 March 2024 diff hist +1‎ m 22111:Course plan autumn 2023 ‎ →‎Tuesday Oct 31 — Weight matrices and other prediction methods
• 10:4910:49, 15 March 2024 diff hist +1‎ m 22111:Course plan autumn 2023 ‎ →‎Tuesday Oct 31 — Weight matrices and other prediction methods
• 10:4610:46, 15 March 2024 diff hist +82‎ m 22111:Course plan autumn 2023 ‎ →‎Tuesday Oct 31 — Weight matrices and other prediction methods
• 10:4210:42, 15 March 2024 diff hist 0‎ N File:Q11 pseudo 200.png ‎No edit summary current
• 10:4210:42, 15 March 2024 diff hist 0‎ N File:Q11 pseudo 00.png ‎No edit summary current
• 10:4110:41, 15 March 2024 diff hist 0‎ N File:Q9 EUK.png ‎No edit summary current
• 10:4110:41, 15 March 2024 diff hist 0‎ N File:Q8 gram pos.png ‎No edit summary current
• 10:4110:41, 15 March 2024 diff hist 0‎ N File:Q8 gram neg.png ‎No edit summary current