ExMulAlign-Answers-English: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

15 March 2024

  • curprev 11:1511:15, 15 March 2024‎ WikiSysop talk contribs‎ 21,840 bytes +125‎ →‎Question 1
  • curprev 11:1211:12, 15 March 2024‎ WikiSysop talk contribs‎ 21,715 bytes +21,715‎ Created page with "Click here for Danish version. =Answers to the Multiple Alignment exercise= By: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] ==Question 1== FASTA file: >pigeon_alpha-D-globin ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACTT GCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGGCCGCCTTGGGC..."
Retrieved from "https://teaching.healthtech.dtu.dk/22111/index.php/ExMulAlign-Answers-English"