All public logs
Jump to navigation
Jump to search
Combined display of all available logs of 22140. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 15:54, 5 March 2024 WikiSysop talk contribs uploaded File:1000px-DNA replication en.svg.png
- 15:54, 5 March 2024 WikiSysop talk contribs created page File:Igraph hemoglobin.png
- 15:54, 5 March 2024 WikiSysop talk contribs uploaded File:Igraph hemoglobin.png
- 14:37, 5 March 2024 WikiSysop talk contribs created page File:Hemoglobin structure 200px.png
- 14:37, 5 March 2024 WikiSysop talk contribs uploaded File:Hemoglobin structure 200px.png
- 13:48, 5 March 2024 WikiSysop talk contribs created page File:SelecetionBlock.png
- 13:48, 5 March 2024 WikiSysop talk contribs uploaded File:SelecetionBlock.png
- 13:48, 5 March 2024 WikiSysop talk contribs created page File:SelecetionNormal.png
- 13:48, 5 March 2024 WikiSysop talk contribs uploaded File:SelecetionNormal.png
- 13:47, 5 March 2024 WikiSysop talk contribs created page File:Mac Finder icon.png
- 13:47, 5 March 2024 WikiSysop talk contribs uploaded File:Mac Finder icon.png
- 13:44, 5 March 2024 WikiSysop talk contribs created page File:NotePad WinFile.png
- 13:44, 5 March 2024 WikiSysop talk contribs uploaded File:NotePad WinFile.png
- 13:44, 5 March 2024 WikiSysop talk contribs created page File:NotePad UnixFile.png
- 13:44, 5 March 2024 WikiSysop talk contribs uploaded File:NotePad UnixFile.png
- 13:42, 5 March 2024 WikiSysop talk contribs created page File:Ascii1.png
- 13:42, 5 March 2024 WikiSysop talk contribs uploaded File:Ascii1.png
- 13:41, 5 March 2024 WikiSysop talk contribs created page File:WordFormat small.png
- 13:41, 5 March 2024 WikiSysop talk contribs uploaded File:WordFormat small.png
- 13:40, 5 March 2024 WikiSysop talk contribs created page ExJEdit (Created page with "Written by: [http://www.dtu.dk/service/telefonbog/person?id=18103&cpid=214039&tab=2&qt=dtupublicationquery Rasmus Wernersson] (with some editing by Henrik Nielsen). == Background: data in plain text format == In bioinformatics it's very common to have the data hosted in simple '''plain text''' format. For example: >pigeon_alpha-globin-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCACCCAGACTGTG GAGCCGAGGCCCTGGAGAGGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCCCC...")
- 13:39, 5 March 2024 WikiSysop talk contribs created page File:JEdit screenshot.png
- 13:39, 5 March 2024 WikiSysop talk contribs uploaded File:JEdit screenshot.png
- 13:15, 5 March 2024 WikiSysop talk contribs created page IgraphIntro Ex v1 (Created page with "= Introduction to working with networks in R = '''Exercise written by:''' Rasmus Wernersson and Lars Rønn Olsen The purpose is to give a general introduction to the R packages [https://r.igraph.org/ '''igraph'''] and [http://users.dimi.uniud.it/~massimo.franceschet/ns/syllabus/make/ggraph/ggraph.html '''ggraph'''], which we will be using for a large part of the course for: # Building and storing networks in R # Visualization / inspection of biological networks # Data...")
- 13:13, 5 March 2024 WikiSysop talk contribs created page ExUniProt-answers (Created page with "== Answers to "Exercise: Protein databases" == The numbers are found using UniProt on Feb 10, 2017 (release 2017_01). ===Simple text mining=== '''QUESTION 1:''' # How many hits do you find? <br>3150 # How many of these hits are from Swiss-Prot? <br>1254 # Can you identify the correct hit (''i.e.'' see which one is actually human insulin and not something else)? <br>It's P01308 / INS_HUMAN (among the first ten hits). '''QUESTION 2:''' How many hits are now left? How m...")
- 13:12, 5 March 2024 WikiSysop talk contribs created page File:Uniprotlogo.gif
- 13:12, 5 March 2024 WikiSysop talk contribs uploaded File:Uniprotlogo.gif
- 13:10, 5 March 2024 WikiSysop talk contribs created page File:UniProt-search-button.png
- 13:10, 5 March 2024 WikiSysop talk contribs uploaded File:UniProt-search-button.png
- 13:09, 5 March 2024 WikiSysop talk contribs created page File:Office-notes-line drawing.png
- 13:09, 5 March 2024 WikiSysop talk contribs uploaded File:Office-notes-line drawing.png
- 13:08, 5 March 2024 WikiSysop talk contribs created page File:Emblem-important tiny.png
- 13:08, 5 March 2024 WikiSysop talk contribs uploaded File:Emblem-important tiny.png
- 13:06, 5 March 2024 WikiSysop talk contribs created page Exercise: The protein database UniProt (Created page with "Exercise written by: Henrik Nielsen - updated by Morten Nielsen and Rasmus Wernersson right|frame|UniProt logo as of 2010 - source: http://www.uniprot.org __TOC__ In this exercise, we shall extract information from the protein database, Uniprot. This database is administrated in collaboration between [http://www.isb-sib.ch/ Swiss Institute of Bioinformatics (SIB)], [http://www.ebi.ac.uk/ European Bioinformatics Institute (EBI)], England, and [ht...")
- 13:05, 5 March 2024 WikiSysop talk contribs created page Autumn2023 (Created page with "= Course 22140 - plan for autumn 2023 = <!-- = General information = --> '''Teachers:''' * Lars Rønn Olsen (course organizer) - '''contact:''' [mailto:lronn@dtu.dk lronn@dtu.dk] * Kristoffer Vitting-Seerup (course organizer) - '''contact:''' [mailto:krivi@dtu.dk krivi@dtu.dk] * Rasmus Wernersson (external lecturer) - '''contact:''' [mailto:rawe@dtu.dk rawe@dtu.dk] * Hanxi Li (teaching assistant) - '''contact:''' [mailto:hanxli@dtu.dk hanxli@dtu.dk] <!-- '''Main cour...")
- 13:01, 5 March 2024 WikiSysop talk contribs created page MediaWiki:Sidebar (Created page with " * navigation ** https://teaching.healthtech.dtu.dk/|Course List ** https://teaching.healthtech.dtu.dk/22101/|22140/22141 * TOOLBOX")
- 12:57, 5 March 2024 WikiSysop talk contribs created page File:Network example1.png
- 12:57, 5 March 2024 WikiSysop talk contribs uploaded File:Network example1.png
- 12:55, 5 March 2024 WikiSysop talk contribs created page 22140/22141 - Introduction to Systems Biology (Created page with "'' Previously known as 36040 and 27040: Introduction to Systems Biology (bachelor course) '' <!-- This is the main page for the ''"Introduction to Systems Biology"'' course (previously known as '''27040''' but not to be confused with the Master's level course '''27641''') --> 600px|center|Network example: Protein-Protein interaction network for biomarkers involved in depression - Larsen & Wernersson, 2012. == About the course == The ''"Int...")
- 12:53, 5 March 2024 WikiSysop talk contribs created page MediaWiki:Mainpage (Created page with "22140/22141 - Introduction to Systems Biology")
- 12:52, 5 March 2024 WikiSysop talk contribs created page MediaWiki:Disclaimers (Created blank page)
- 12:51, 5 March 2024 WikiSysop talk contribs created page MediaWiki:Aboutsite (Created blank page)
- 12:51, 5 March 2024 WikiSysop talk contribs created page MediaWiki:Privacy (Created blank page)