Mick at 13:58, 20 November 2025

2025-11-20T13:58:49Z

WikiSysop: Created page with "'''Q1''' Running:

 java -jar /home/ctools/picard_2.23.8/picard.jar MarkDuplicates -I /home/projects/22126_NGS/exercises/dupremoval/ERR016028_chr20_sort.bam -M  ERR016028_chr20_sort_markdup.metrics.txt -O ERR016028_chr20_sort_markdup.bam

The log should state:

 Marking 9798 records as duplicates.

Please note that this is very low but that is because we have very little data so that it runs faster. '''Q2''' They do not have the same sequence:..."

2024-03-19T15:29:34Z

Created page with "'''Q1''' Running: <pre> java -jar /home/ctools/picard_2.23.8/picard.jar MarkDuplicates -I /home/projects/22126_NGS/exercises/dupremoval/ERR016028_chr20_sort.bam -M ERR016028_chr20_sort_markdup.metrics.txt -O ERR016028_chr20_sort_markdup.bam </pre> The log should state: <pre> Marking 9798 records as duplicates. </pre> Please note that this is very low but that is because we have very little data so that it runs faster. '''Q2''' They do not have the same sequence:..."

New page

'''Q1'''
Running:

<pre>
java -jar /home/ctools/picard_2.23.8/picard.jar MarkDuplicates -I /home/projects/22126_NGS/exercises/dupremoval/ERR016028_chr20_sort.bam -M ERR016028_chr20_sort_markdup.metrics.txt -O ERR016028_chr20_sort_markdup.bam
</pre>

The log should state:

<pre>
Marking 9798 records as duplicates.
</pre>
Please note that this is very low but that is because we have very little data so that it runs faster.

'''Q2'''

They do not have the same sequence:
<pre>
ERR016028.5947720 ACATGTGGCTAATTTTTTTTACTGTTGTGGAGAAAGGAGGAGGGAGAGGGGAGTCTCATTATCTTGCCCAGGCTAG
ERR016028.18808080 ACATGTGGCTAATTTTTTTTACTGTTGTGGAGAAAGGAGGAGGGAGAGGGGAGTCNCATTATCTTGCCCAGGCTAG
</pre>
notice "TCTCA" vs "TCNCA" but they both have the same starting coordinate (45996739).

'''Q3'''

ERR016028.18808080 is the read marked as duplicate. It is the read whose flag (2nd field) changed from 163 to 1187, which corresponds to a duplicate (see [https://broadinstitute.github.io/picard/explain-flags.html https://broadinstitute.github.io/picard/explain-flags.html]).

'''Q4'''

The correct command is:
<pre>
samtools merge
</pre>
If you choose:
<pre>
samtools cat
</pre>
It will merely concatenate the files meaning that they will be file1, file2, file3.. It will not necessarily be sorted.

The full command should look something like this:
<pre>
samtools merge -c --write-index HG00418_chr20_sort_markdup.bam ERR016028_chr20_sort_markdup.bam /home/projects/22126_NGS/exercises/dupremoval/ERR016025_chr20_sort_markdup.bam
</pre>

'''Q5'''

It is '''RG''' which stands for read group. You will see them at the end of reads:

<pre>
RG:Z:ERR016025
RG:Z:ERR016028
</pre>

If it was '''RG:Z:ERR016025''' it was from the file that was stored, '''RG:Z:ERR016028''' was from the file you generated.

'''Q6''' multiplexing

'''Q7''' demultiplexing

Postprocess exercise answers - Revision history

Mick at 13:58, 20 November 2025