Exercise:BLAST new - Revision history

Carol: /* Introduction */

2026-09-19T12:45:07Z

Introduction

← Older revision		Revision as of 14:45, 19 September 2026
Line 8:		Line 8:
	After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified.		After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified.

	For the exercise, we will be using two approaches; the Web interface to '''BLAST''' hosted by the '''NCBI''', and ~~from~~ a ~~Python~~ Notebook using Google Colab. There are several advantages to each approach:		For the exercise, we will be using two approaches; the Web interface to '''BLAST''' hosted by the '''NCBI''', and using the '''BioPython library'' in a Notebook using '''Google Colab'''. There are several advantages to each approach:

	The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.		The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.

Carol: /* Introduction */

2026-09-19T12:43:13Z

Introduction

← Older revision		Revision as of 14:43, 19 September 2026
Line 8:		Line 8:
	After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified.		After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified.

	For the exercise, we will be using the Web interface to '''BLAST hosted by the NCBI''' and from a Python Notebook using Google Colab. There are several advantages to each approach:		For the exercise, we will be using two approaches; the Web interface to '''BLAST''' hosted by the '''NCBI''', and from a Python Notebook using Google Colab. There are several advantages to each approach:

	The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.		The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.

Carol: /* Introduction */

2026-09-19T12:39:58Z

Introduction

← Older revision		Revision as of 14:39, 19 September 2026
Line 3:		Line 3:
	==Introduction==		==Introduction==

	In this exercise you will learn by doing to BLAST ('''B'''asic '''L'''ocal '''A'''lignment '''S'''earch '''T'''ool~~) DNA and protein sequences~~.		In this exercise you will learn by doing to BLAST DNA and protein sequences.
	After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified		BLAST is short for '''B'''asic '''L'''ocal '''A'''lignment '''S'''earch '''T'''ool.

	For the exercise, we will be using the Web interface to '''BLAST hosted by the NCBI''' and from a Python Notebook ~~from~~ Google Colab. There are several advantages to each approach:		After completion of the exercise you should be able to choose an appropriate BLAST search tool selecting the correct set of parameters, interpret a BLAST result, explain what an E-value means and how database size affects it, and decide what biological conclusion is justified.

			For the exercise, we will be using the Web interface to '''BLAST hosted by the NCBI''' and from a Python Notebook using Google Colab. There are several advantages to each approach:

	The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.		The Web interface is very intuitive as it provides a graphical summary and links to other databases, while the programmatic way is more flexible allowing us to further customize the search, the output, and do many searches in a single run for a batch of query sequences.

Carol: /* Search against a broad database */

2026-09-18T16:54:00Z

Search against a broad database

← Older revision		Revision as of 18:54, 18 September 2026
Line 100:		Line 100:
	:* What is the E-value?		:* What is the E-value?
	:* Are there any gaps in the alignment?		:* Are there any gaps in the alignment?


	'''Blast Job ID: XXX'''		'''Blast Job ID: XXX'''
			<!--
			:* Which database did you use? core_nt
			:* What is the identifier (Accession)? NM_001008996.2
			:* What is the alignment score ("max score")? 751
			:* What is the percent identity and query coverage? 100%
			:* What is the E-value? 0
			:* Are there any gaps in the alignment? No
			-->

	Then, find the best hit from human (''Homo sapiens'') that is ''not'' a synthetic construct. ('''Tip:''' you can press Ctrl-F in most browsers to search in the page).		Then, find the best hit from human (''Homo sapiens'') that is ''not'' a synthetic construct. ('''Tip:''' you can press Ctrl-F in most browsers to search in the page).

Carol: /* Search against a broad database */

2026-09-18T16:51:41Z

Search against a broad database

← Older revision		Revision as of 18:51, 18 September 2026
Line 89:		Line 89:
	* Accession - the accession ID of the matched sequence		* Accession - the accession ID of the matched sequence
	-->		-->

	First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!		First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!

Carol: /* Search against a broad database */

2026-09-18T16:51:13Z

Search against a broad database

← Older revision		Revision as of 18:51, 18 September 2026
Line 61:		Line 61:
	<!--The main difference is that core_nt excludes most eukaryotic chromosome sequences, making it smaller and faster than nr/nt, so NCBI uses it as the default for more efficient searches.-->		<!--The main difference is that core_nt excludes most eukaryotic chromosome sequences, making it smaller and faster than nr/nt, so NCBI uses it as the default for more efficient searches.-->

	Based on the answer of Question 1, choose the most efficient database from the two.		Based on the answer of Question 1.1, choose the most efficient database from the two.
	In the section "<u>Program Selection</u>" select the option "<u>Somewhat similar sequences (blastn)</u>"		In the section "<u>Program Selection</u>" select the option "<u>Somewhat similar sequences (blastn)</u>"
	Click the <u>BLAST</u> button to launch the search.		Click the <u>BLAST</u> button to launch the search.

	After the search has been completed, make yourself familiar with the BLAST output page. Note that you can toggle between hiding and showing each tab by clicking on the title (try it!).		After the search has been completed, make yourself familiar with the BLAST output page. Note that you can toggle between hiding and showing each tab by clicking on the title: Descriptions, Graphic Summary, Alignments and Taxonomy (try it!).

			<!--
	'''Descriptions'''		'''Descriptions'''
	:A table with a one-line description of each hit with some alignment statistics.		:A table with a one-line description of each hit with some alignment statistics.
Line 76:		Line 77:
	:The actual alignments between the query and the database hits.		:The actual alignments between the query and the database hits.

	~~<!--~~
	The columns in the '''Descriptions''' tab are:		The columns in the '''Descriptions''' tab are:

Line 97:		Line 97:
	:* Which database did you use?		:* Which database did you use?
	:* What is the identifier (Accession)?		:* What is the identifier (Accession)?
	:* ~~what~~ is the alignment score ("max score")?		:* What is the alignment score ("max score")?
	:* ~~what~~ is the percent identity and query coverage?		:* What is the percent identity and query coverage?
	:* ~~what~~ is the E-value?		:* What is the E-value?
	:* ~~are~~ there any gaps in the alignment?		:* Are there any gaps in the alignment?

	'''Blast Job ID: XXX'''		'''Blast Job ID: XXX'''

Carol: /* Part 1: Your first BLAST search */

2026-09-18T16:48:55Z

Part 1: Your first BLAST search

← Older revision		Revision as of 18:48, 18 September 2026
Line 29:		Line 29:
	==Part 1: Your first BLAST search==		==Part 1: Your first BLAST search==

	Below is the mRNA sequence for insulin from ~~a South American rodent~~, the ~~Degu~~ (''~~Octodon degus~~'').		Below is the mRNA sequence for insulin from our closest relative, the common chimpanzee (''Pan troglodytes'').

	>~~gi\|202471\|gb\|M57671~~.~~1\|OCOINS Octodon degus~~ insulin mRNA~~, complete cds~~		>NM_001008996.2 Pan troglodytes insulin (INS), mRNA
	~~GCATTCTGAGGCATTCTCTAACAGGTTCTCGACCCTCCGCCATGGCCCCGTGGATGCATCTCCTCACCGT~~		AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGATCACTGTCCTTCTGCCATGGCCCTGTG
	~~GCTGGCCCTGCTGGCCCTCTGGGGACCCAACTCTGTTCAGGCCTATTCCAGCCAGCACCTGTGCGGCTCC~~		GATGCGCCTCCTGCCCCTGCTGGTGCTGCTGGCCCTCTGGGGACCTGACCCAGCCTCGGCCTTTGTGAAC
	~~AACCTAGTGGAGGCACTGTACATGACATGTGGACGGAGTGGCTTCTATAGACCCCACGACCGCCGAGAGC~~		CAACACCTGTGCGGCTCCCACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACA
	~~TGGAGGACCTCCAGGTGGAGCAGGCAGAACTGGGTCTGGAGGCAGGCGGCCTGCAGCCTTCGGCCCTGGA~~		CACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGC
	~~GATGATTCTGCAGAAGCGCGGCATTGTGGATCAGTGCTGTAATAACATTTGCACATTTAACCAGCTGCAG~~		AGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGTATCGTGGAACAATGCTGTACC
	~~AACTACTGCAATGTCCCTTAGACACCTGCCTTGGGCCTGGCCTGCTGCTCTGCCCTGGCAACCAATAAAC~~		AGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGATGGAATAAAGCCCTTGAACCAGC
	~~CCCTTGAATGAG~~

	We will use BLAST to determine whether this sequence looks like the human mRNA for insulin. There are two ways we can do this:		We will use BLAST to determine whether this sequence looks like the human mRNA for insulin. There are two ways we can do this:
Line 97:		Line 96:
	:Answer the following questions about the best hit:		:Answer the following questions about the best hit:
	:* Which database did you use?		:* Which database did you use?
	:* ~~what~~ is the identifier (Accession)?		:* What is the identifier (Accession)?
	:* what is the alignment score ("max score")?		:* what is the alignment score ("max score")?
	:* what is the percent identity and query coverage?		:* what is the percent identity and query coverage?

Carol: /* Search against a broad database */

2026-09-18T16:38:34Z

Search against a broad database

← Older revision		Revision as of 18:38, 18 September 2026
Line 77:		Line 77:
	:The actual alignments between the query and the database hits.		:The actual alignments between the query and the database hits.

			<!--
	The columns in the '''Descriptions''' tab are:		The columns in the '''Descriptions''' tab are:

Line 88:		Line 89:
	* Acc. Len — the accession length		* Acc. Len — the accession length
	* Accession - the accession ID of the matched sequence		* Accession - the accession ID of the matched sequence
			-->

	First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!		First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!

Carol: /* Search against a broad database */

2026-09-18T16:36:35Z

Search against a broad database

← Older revision		Revision as of 18:36, 18 September 2026
Line 79:		Line 79:
	The columns in the '''Descriptions''' tab are:		The columns in the '''Descriptions''' tab are:

			* Scientific Name — The species name of the matched sequence
	* Description — the description line from the database		* Description — the description line from the database
	* Max score — the alignment score of the best match (local alignment) between the query and the database hit		* Max score — the alignment score of the best match (local alignment) between the query and the database hit
Line 86:		Line 87:
	* Per. Ident — the percent identity in the alignment(s)		* Per. Ident — the percent identity in the alignment(s)
	* Acc. Len — the accession length		* Acc. Len — the accession length
			* Accession - the accession ID of the matched sequence

	First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!		First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!

Carol: /* Search against a broad database */

2026-09-18T16:35:03Z

Search against a broad database

← Older revision		Revision as of 18:35, 18 September 2026
Line 67:		Line 67:

	After the search has been completed, make yourself familiar with the BLAST output page. Note that you can toggle between hiding and showing each tab by clicking on the title (try it!).		After the search has been completed, make yourself familiar with the BLAST output page. Note that you can toggle between hiding and showing each tab by clicking on the title (try it!).

			'''Descriptions'''
			:A table with a one-line description of each hit with some alignment statistics.

	'''Graphic Summary'''		'''Graphic Summary'''
	:Each hit is represented by a line showing which part of the query sequence the alignment covers. The lines are coloured according to the alignment score.		:Each hit is represented by a line showing which part of the query sequence the alignment covers. The lines are coloured according to the alignment score.
	~~'''Descriptions'''~~
	~~:A table with a one-line description of each hit with some alignment statistics.~~
	'''Alignments'''		'''Alignments'''
	:The actual alignments between the query and the database hits.		:The actual alignments between the query and the database hits.

			The columns in the '''Descriptions''' tab are:
	The columns in the '''Descriptions''' ~~table~~ are:

	* Description — the description line from the database		* Description — the description line from the database
Line 86:		Line 87:
	* Acc. Len — the accession length		* Acc. Len — the accession length

	First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of NR, we should find an identical sequence in the search. Make sure this is the case!		First, take a look at the best hit. Since our search sequence (the query) was taken from GenBank which is part of this broad database, we should find an identical sequence in the search. Make sure this is the case!

	[[Image:Office-notes-line_drawing.png\|30px\|left]]		[[Image:Office-notes-line_drawing.png\|30px\|left]]
	:'''QUESTION 1.2''':		:'''QUESTION 1.2''':
	:Answer the following questions about the best hit:		:Answer the following questions about the best hit:
			:* Which database did you use?
	:* what is the identifier (Accession)?		:* what is the identifier (Accession)?
	:* what is the alignment score ("max score")?		:* what is the alignment score ("max score")?
Line 97:		Line 99:
	:* are there any gaps in the alignment?		:* are there any gaps in the alignment?

	Blast Job ID: ~~DU7P2YFF014~~		'''Blast Job ID: XXX'''